ID: 978008295

View in Genome Browser
Species Human (GRCh38)
Location 4:103646902-103646924
Sequence CTTAGGGAACAGTATGATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978008295 Original CRISPR CTTAGGGAACAGTATGATAT AGG Intronic
903203114 1:21759559-21759581 TTTAGGGCACAGTAAGATGTAGG - Intronic
903804174 1:25992350-25992372 GGTAGGGAAAAGTATGATGTGGG + Intronic
905665254 1:39759810-39759832 CTGAGTGAACAGCATGATTTAGG - Exonic
907764253 1:57392920-57392942 CTTAAGAGACAGTATCATATTGG + Intronic
910777373 1:90890701-90890723 CTTAGGGCCCAGTATGAGACTGG + Intergenic
911010256 1:93273411-93273433 GTTAAGGCACAGTAAGATATTGG + Intronic
911900964 1:103503268-103503290 CTTACAGAAGAGTATGGTATTGG + Intergenic
912990745 1:114483810-114483832 CTTTGGTAACAGGGTGATATTGG - Intronic
918397125 1:184124670-184124692 CTTATGGAAGAGTATGGTGTTGG + Intergenic
919956482 1:202421963-202421985 CTTAGGCAACATTATGAAGTAGG - Intronic
920765346 1:208827154-208827176 ATGAGGGAACAGTAACATATAGG + Intergenic
924015194 1:239713673-239713695 CTGACATAACAGTATGATATAGG - Intronic
1065001535 10:21341998-21342020 CTTATGGAAAAGTATAATTTGGG + Intergenic
1066170974 10:32845416-32845438 CTTATGTAACACTATAATATAGG - Intronic
1068225116 10:54098288-54098310 GTTAGGGAACAGTTTGTTCTGGG + Intronic
1070676166 10:78413025-78413047 CTCAGAAAAGAGTATGATATGGG + Intergenic
1071373278 10:84975598-84975620 CTTTGGTATCAGGATGATATTGG - Intergenic
1072373525 10:94790854-94790876 CTTTGGTATCAGTATGATACTGG + Intronic
1072818738 10:98535523-98535545 CTAAGAAAACAGTATGACATGGG - Intronic
1074117997 10:110472035-110472057 CTTAGAGAAAAGTAGGATGTGGG + Intergenic
1074396150 10:113099559-113099581 CTTAGGGAAAAGTACAATGTAGG + Intronic
1077501916 11:2913154-2913176 CTGAGGGAGCAGCAGGATATGGG + Intronic
1079779317 11:24579958-24579980 CTTAGTGATCAGTATGAAACAGG + Intronic
1082106209 11:48224475-48224497 CTTGAGGAAAAGTATGAAATCGG - Intergenic
1083504565 11:63143678-63143700 ATTAGGGAACAGTAGGATGTTGG + Exonic
1085133528 11:74063283-74063305 CTTTGGTATCAGTATGATGTTGG - Intronic
1085176987 11:74497164-74497186 CTTACGGAAGAGTATGGTGTTGG + Intronic
1092763890 12:11835309-11835331 CACAGGGAATAGTATAATATAGG + Intronic
1093700677 12:22216684-22216706 CTTAGGGAACAGCAAGATAAAGG - Intronic
1095786468 12:46114720-46114742 CTTTGGTATCAGGATGATATTGG - Intergenic
1096048587 12:48586406-48586428 CCTAGGGAACAGGAAGAGATAGG + Intergenic
1096372131 12:51077691-51077713 TTTATGGAGCAGTATGAGATTGG - Intronic
1099475880 12:83107039-83107061 GTTAGGGCAGAGGATGATATAGG + Intronic
1099511719 12:83546853-83546875 CTTTGGTAACAGGATGATGTTGG + Intergenic
1104797948 12:131532678-131532700 CTTACAGAAGAGTTTGATATTGG + Intergenic
1107918227 13:45174852-45174874 TTTATGGTACAGTATGATTTTGG + Intronic
1109733764 13:66453420-66453442 ATTAGGGAACAATATCACATAGG - Intronic
1111178727 13:84634999-84635021 CATGGGGAGCACTATGATATGGG + Intergenic
1111356542 13:87113159-87113181 CTTAGTGAACAATATTTTATAGG - Intergenic
1111897026 13:94154872-94154894 CTTACTGAACAAAATGATATTGG - Intronic
1111945039 13:94655988-94656010 CTTACAGGAGAGTATGATATTGG + Intergenic
1112866687 13:103909963-103909985 GTTAGGAAACAATATGATTTAGG + Intergenic
1112941996 13:104874941-104874963 CTTATGAAACAGAATGATCTAGG + Intergenic
1114923149 14:27360028-27360050 CTTTGGGATCAGGATGATGTTGG + Intergenic
1115323209 14:32107993-32108015 GCTAGTGAAGAGTATGATATGGG + Intronic
1117003489 14:51395092-51395114 CTTTGGGAACAGTAGGAGGTGGG - Intergenic
1117586521 14:57213021-57213043 CTTACAGAAGAGTATGGTATTGG - Intronic
1122854690 14:104554442-104554464 CTTAGGGAACAGCAGGACAGAGG - Intronic
1124129154 15:26969826-26969848 ATTAGGGCAGAGTATGATAAAGG + Intergenic
1125315648 15:38428319-38428341 CTTTGAAAACAGGATGATATTGG + Intergenic
1125902182 15:43358922-43358944 CTTGAGGAATAGTATGATATGGG - Exonic
1127980101 15:64028565-64028587 CTTAGGTAAAAATATTATATTGG + Intronic
1129680166 15:77654425-77654447 CTTAGGGAAGAGCATGGTCTTGG - Intronic
1137844752 16:51676231-51676253 CTTAGGGATCAGAAAGATCTGGG - Intergenic
1138841478 16:60513615-60513637 CTTTGTGTACAGTGTGATATAGG + Intergenic
1139313609 16:66048363-66048385 CTAAGTGGACAGTACGATATTGG + Intergenic
1146130011 17:30264365-30264387 CTTAGAGAACTGTAAAATATGGG - Intronic
1156542469 18:37928557-37928579 TTCAGGGCACAGCATGATATAGG + Intergenic
1156864310 18:41872005-41872027 GTTAGGGGACTGTGTGATATGGG - Intergenic
1164439693 19:28264233-28264255 CTTAAGGAACAGTATGACATGGG + Intergenic
1164538326 19:29103414-29103436 CTTACAGAACAGTAGGATGTGGG + Intergenic
1168578224 19:57531352-57531374 CTTAGAGATGAGAATGATATGGG + Intronic
925117478 2:1392490-1392512 CTTTGGGATCAGGATGATGTTGG + Intronic
927637761 2:24828510-24828532 CTGAAGCAACAGTGTGATATGGG - Intronic
930402368 2:50906608-50906630 CTTAAGGAACAGGATCAGATTGG - Intronic
931354562 2:61524367-61524389 TTTAGGTAACAGTATCAAATAGG - Intronic
931431758 2:62214185-62214207 CTGAGGGAACAGTAGCATATTGG + Intronic
932924977 2:75962974-75962996 AAAAGGGAACAGTAAGATATAGG + Intergenic
935507314 2:103921633-103921655 CTTAAGGAACAGTGACATATAGG - Intergenic
936823843 2:116556424-116556446 CTTTGGTATCAGGATGATATTGG - Intergenic
938001653 2:127745331-127745353 CTTTGGGACCAGTGTGATGTTGG + Intronic
941306522 2:163875754-163875776 TTTAGGGAACATTATGTCATTGG - Intergenic
941598314 2:167506469-167506491 CTTAGGGAAAAGTGTTATGTAGG + Intergenic
942208131 2:173643660-173643682 CTTATGGAAGAGTATGGTGTTGG + Intergenic
942536945 2:176974998-176975020 CTTAGGGAGCAGCATGATAAGGG - Intergenic
943203053 2:184854633-184854655 CTTACAGAAGAGTATGATGTTGG + Intronic
945333368 2:208563846-208563868 CTCAGGAAACAGTAAGATGTAGG - Intronic
947078520 2:226369931-226369953 CTTACTGAACAGGATGTTATGGG - Intergenic
948419345 2:237845946-237845968 CTTTGGTATCAGGATGATATTGG + Intergenic
1169013143 20:2268108-2268130 CTTTGGTATCAGGATGATATTGG - Intergenic
1171995648 20:31728873-31728895 CCTAGGGAACAAGATGAAATTGG + Intergenic
1172259752 20:33552848-33552870 CAGAGGGAACAGAATAATATAGG - Intronic
1174617000 20:51843400-51843422 CTTATTGCACAGTATGATAATGG + Intergenic
1180598747 22:16999126-16999148 CTTTGGTAACAGGATGATGTTGG + Intronic
1181525167 22:23479709-23479731 GTGAGGGGACAGAATGATATGGG + Intergenic
1185032572 22:48452205-48452227 CTTGGGGAACTGGATGAGATTGG + Intergenic
949456303 3:4242759-4242781 CTTTGGGATCAGGATGATGTTGG + Intronic
951602659 3:24393790-24393812 CTTAAGGAACAGAATAATGTAGG + Intronic
951954996 3:28243716-28243738 CCTAGGGAACAGTAGTACATAGG + Intronic
952978398 3:38715526-38715548 CTCAGGGAACAATTTGATTTGGG - Intronic
957252315 3:77788939-77788961 ATTAGGGAACATTATGATTTTGG - Intergenic
959796498 3:110435894-110435916 CTTAGGGAACGGTATGAAGTAGG + Intergenic
962645429 3:137434161-137434183 CTTTGGTAGCAGTATGACATTGG - Intergenic
966521956 3:180883180-180883202 TTTAGGGAAAAGAATGTTATTGG - Intronic
976577511 4:86691347-86691369 TTTGGGGAACAGTATGACATGGG + Intronic
976578606 4:86706653-86706675 CTTTGGGAACAAAATGAGATAGG + Intronic
978008295 4:103646902-103646924 CTTAGGGAACAGTATGATATAGG + Intronic
978184329 4:105839226-105839248 TTTAGGAAACTGTATGATTTTGG + Intronic
978383350 4:108154278-108154300 CTTAAGGAACCGTATTAAATTGG + Intronic
978511128 4:109519248-109519270 TGTATGGAAAAGTATGATATAGG + Intronic
980792993 4:137643674-137643696 CTTATAGAACAGTATGGTGTTGG + Intergenic
988046671 5:25964221-25964243 TTTAGGGAACAGTCTGATTTTGG + Intergenic
988316100 5:29630533-29630555 ATTTGGTAACTGTATGATATTGG - Intergenic
990804651 5:59645410-59645432 CCAAGGGAAAAGTGTGATATAGG - Intronic
992032035 5:72731247-72731269 CTTTGGTAACAGGATGATGTTGG - Intergenic
992165727 5:74049381-74049403 CTTGGGGAACATTATGACTTGGG - Intergenic
995663436 5:114512442-114512464 CTTAGGCAACAGTAGAAAATAGG + Intergenic
999832755 5:155336490-155336512 CTTAGGGATCAGTCAGATGTTGG + Intergenic
1003764320 6:9218082-9218104 CTTTGGTATCAGGATGATATTGG - Intergenic
1004010798 6:11685359-11685381 CTTAGGGAACATGCTGAGATCGG + Intergenic
1005073978 6:21889215-21889237 CTTTTAGTACAGTATGATATGGG + Intergenic
1005343848 6:24869734-24869756 CTGACAGAACAGTATCATATTGG + Intronic
1008954953 6:57205376-57205398 CTTAGGAGACAGTATCATTTTGG - Intronic
1010858482 6:80873528-80873550 TTTAGGGAATAATATAATATTGG - Intergenic
1016621951 6:146120923-146120945 CTTTGGTATCAGTATGATACTGG + Intronic
1017211019 6:151856628-151856650 CTTAAGAAAAAGTATTATATAGG - Intronic
1017563212 6:155655581-155655603 CTTAGGGTGCAGTTTGATGTTGG - Intergenic
1020627673 7:10602055-10602077 GTTAGGGAACAGCATGGTGTTGG - Intergenic
1024369272 7:48560981-48561003 ATTAGAGAACATTATGTTATGGG - Intronic
1024407119 7:48994545-48994567 TTAAGGATACAGTATGATATTGG - Intergenic
1024817168 7:53284811-53284833 CTTTGGTAACAGGATGATACTGG + Intergenic
1026485165 7:70811922-70811944 CTTTGGTATCAGGATGATATTGG + Intergenic
1033858445 7:145594760-145594782 CTTGGGAAACATTATCATATTGG - Intergenic
1041842723 8:62290725-62290747 CTTTGGTATCAGGATGATATTGG + Intronic
1051215810 9:14796141-14796163 CATAGGGAACAGCAGGATATGGG + Intronic
1051584718 9:18714753-18714775 CTTTGGTATCAGTATGATACTGG - Intronic
1055725857 9:79227975-79227997 CTTAGGGAAGAGCATGTCATTGG - Intergenic
1056742425 9:89269409-89269431 CTTAGGGAAAAGCTTGACATTGG - Intergenic
1057597713 9:96430441-96430463 CTTACAGAACAGTATGGTGTTGG - Intergenic
1058060566 9:100491488-100491510 CTTAGGGAACATTAATTTATAGG + Intronic
1058207716 9:102129305-102129327 CTTTGGTATCAGGATGATATTGG + Intergenic
1186123647 X:6389188-6389210 CTGAGGGGACAGAATGAAATGGG - Intergenic
1193302700 X:79909930-79909952 CTTTGGCATCAGTATAATATTGG + Intergenic
1194305033 X:92233354-92233376 CTTCAGGAACAATATGACATAGG + Intronic
1199104552 X:143848184-143848206 CTTACAGAAGAGTATGATATTGG + Intergenic
1201605343 Y:15778175-15778197 CTGAGGGGACAGAATGAAATGGG - Intergenic
1202578115 Y:26349213-26349235 CTTAGGCAACATTATGAAGTGGG + Intergenic