ID: 978011628

View in Genome Browser
Species Human (GRCh38)
Location 4:103692559-103692581
Sequence ACCAACTTTCTGTAATTAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 120}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978011628 Original CRISPR ACCAACTTTCTGTAATTAAG AGG Intronic
905142509 1:35859342-35859364 ACAAATTTTCTATAATAAAGAGG - Intergenic
907207831 1:52790209-52790231 ATCTACTTTCTTTAATTTAGTGG + Intronic
909374630 1:74925309-74925331 ACCATCTTTCTGAAATAAGGCGG + Intergenic
909873527 1:80776054-80776076 ACCAACTTTCTGCAAAGCAGTGG - Intergenic
910519862 1:88107696-88107718 ATCAATTTGCTGTAATTAATAGG + Intergenic
914087579 1:144467078-144467100 AACATCTTTCAGGAATTAAGGGG + Intergenic
914193352 1:145430055-145430077 AACATCTTTCAGGAATTAAGGGG + Intergenic
914311032 1:146467129-146467151 AACATCTTTCAGGAATTAAGGGG - Intergenic
915993686 1:160543097-160543119 TCCAACCTTCTTTAATTAAATGG + Intronic
918811209 1:189123297-189123319 ACCAACTTTAAGAAATTAACTGG - Intergenic
920724588 1:208422145-208422167 ATCAACTCTCTATAATTCAGTGG - Intergenic
923495072 1:234517396-234517418 AGCAACTGTCTGTGGTTAAGGGG - Intergenic
1063290910 10:4746936-4746958 AGTAACTTTCTGTCAGTAAGAGG - Intergenic
1066147259 10:32574047-32574069 ACCATCTTTCTAAAATTAAATGG - Intronic
1066554605 10:36597589-36597611 AGAAACTTTCTGTATTTAAAAGG + Intergenic
1066703473 10:38154043-38154065 ATTAACTTTCTGTAATTAGATGG - Intergenic
1068953561 10:62802650-62802672 ACCAGCTTTCATTAGTTAAGAGG - Intergenic
1072679463 10:97496080-97496102 ACCAACTTTCTTTTCTTAGGAGG + Intronic
1080457332 11:32429079-32429101 ACCAACTTTCATTAATTACTCGG + Intronic
1082682780 11:56198101-56198123 ACATAATTTCTTTAATTAAGAGG + Intergenic
1083207746 11:61162832-61162854 TTCAACTTTGTGTAATAAAGTGG - Intergenic
1086843516 11:91718887-91718909 CCCAAATTTCTGTAATTAGAGGG + Intergenic
1093426547 12:19034707-19034729 ACCAACTGGCTGTAAATCAGAGG + Intergenic
1100297192 12:93274041-93274063 ACCACCTTTCCGCAATTTAGAGG + Intergenic
1100948771 12:99821355-99821377 ACAGACTATCTGTAATTAAAGGG + Intronic
1103547651 12:121713215-121713237 ACCAACTTTCTGCAGCGAAGGGG - Intronic
1107399228 13:40052722-40052744 AGCAACTCTCTGTCATAAAGGGG - Intergenic
1110607780 13:77453080-77453102 AGCAAATTTCTGTTGTTAAGAGG + Intergenic
1110872440 13:80468183-80468205 ACTATTTTTCTGTATTTAAGGGG - Intergenic
1111694730 13:91609166-91609188 ACCAGCTCTCTGAAATTAACAGG + Intronic
1111882450 13:93974616-93974638 AACAACCTCCTGTAATTAATAGG + Intronic
1112400218 13:99070787-99070809 ACCAAGTTTCTGTTACTAGGGGG - Intronic
1112924051 13:104651207-104651229 ACCAACTTGGTGGAATTAATGGG + Intergenic
1116165620 14:41330701-41330723 ATTAATTTTCTGTAATAAAGAGG - Intergenic
1117771349 14:59137260-59137282 ACCAAGTTTCTTTAATTGACTGG - Intergenic
1119093462 14:71806502-71806524 ATCAAGTTTCTGCAAATAAGAGG - Intergenic
1125517787 15:40332391-40332413 ACCATCTTCCTGCAATGAAGAGG + Intronic
1127006110 15:54571796-54571818 ACCAACTTCCTGTATTTCACTGG - Intronic
1129384735 15:75189868-75189890 ACAAAAGTTCAGTAATTAAGAGG + Intergenic
1136635369 16:31518384-31518406 ACCAAGTTTATGTAGTTGAGAGG + Intergenic
1139658445 16:68403804-68403826 ACAAATATTCTGTAATGAAGGGG + Intronic
1142302358 16:89266093-89266115 ACCAAAGTTCTGTGATTGAGGGG + Intergenic
1151235175 17:72714720-72714742 ACCACCTTTTTGTGATTATGGGG + Intronic
1153104646 18:1512189-1512211 ACAGACTTCCTGTAAGTAAGAGG + Intergenic
1154941200 18:21114196-21114218 GCCAACTTTTTTTAATAAAGAGG + Intergenic
1155437424 18:25827615-25827637 ACAACATTTCTGTAATAAAGGGG + Intergenic
1158221076 18:55151391-55151413 AGCAACTTTATTAAATTAAGGGG + Intergenic
1158838700 18:61359948-61359970 AACAATTTTCTGTAATTGACTGG - Intronic
1158918605 18:62164201-62164223 TCCAGCTTCTTGTAATTAAGTGG - Intronic
1159011743 18:63064517-63064539 AAAAACATTCTGTAATTTAGTGG + Intergenic
928712300 2:34020733-34020755 ATCAACTTTCTATAATTCTGTGG - Intergenic
931038382 2:58268205-58268227 ACCCACTTTATATAATCAAGTGG + Intergenic
934168265 2:89316751-89316773 ACCAGCTCTTAGTAATTAAGAGG - Intergenic
937406061 2:121630256-121630278 AACAACTTTCTGGAATTTATTGG - Intronic
940463360 2:153996904-153996926 ACCAATTTTCTTTAATTGAATGG + Intronic
940546484 2:155095246-155095268 ACAAAATTTTTGTAATTAAATGG - Intergenic
941738485 2:169007196-169007218 ATCAATTTACTGTAATTAAGAGG - Intronic
943560076 2:189450651-189450673 GCCAACTTTCTGTCTTGAAGAGG - Intronic
943940740 2:193991365-193991387 GCCAACTTTCTGGAAATGAGCGG - Intergenic
945610905 2:212001936-212001958 ACCAAGTTTGTGTAATTTAATGG - Intronic
1169504554 20:6194616-6194638 TCCAACTTTCTGTAAGTTAAAGG - Intergenic
1171080088 20:22172168-22172190 ACTCAATTTCTGTAATTATGTGG + Intergenic
1173239341 20:41279994-41280016 AACAGCTCTCTGTAATAAAGTGG + Intronic
1174468088 20:50732246-50732268 TCCCACTTTCTGTGGTTAAGGGG + Intronic
1174665388 20:52253393-52253415 ACCAATTTTTATTAATTAAGGGG + Intergenic
1178997240 21:37414433-37414455 ACTTACTTTTTGTAATTATGGGG + Intronic
1181837501 22:25622891-25622913 ACATAGTTTCTGTAATTTAGGGG + Intronic
949168418 3:968592-968614 TGCAATTTTCTGTAAATAAGGGG - Intergenic
951369856 3:21832495-21832517 TACAACTTTCTGTAATCATGAGG - Intronic
961389763 3:126545421-126545443 ACCAACTTTCTGCAGTTATGGGG + Intronic
969157040 4:5219994-5220016 ACAAACTTGCTGTAATTATAAGG + Intronic
971711279 4:30116505-30116527 GACAGCTTTCTTTAATTAAGAGG - Intergenic
972282977 4:37621084-37621106 ACCTATTTTCTGTAAGTAACAGG - Intronic
974145532 4:57943069-57943091 AACAATTTTTTGTTATTAAGAGG - Intergenic
974444562 4:61962752-61962774 TTGAACTTTTTGTAATTAAGAGG + Intronic
975257188 4:72251714-72251736 ACCAAGTTTCTGTAAGTCTGGGG + Intergenic
978011628 4:103692559-103692581 ACCAACTTTCTGTAATTAAGAGG + Intronic
979466544 4:121045512-121045534 ACCGATTTTCTGTAAGTAAGGGG - Intronic
982855445 4:160376465-160376487 TCCAGCTTTCTGAAATTAATAGG + Intergenic
982872169 4:160594357-160594379 ACCAAGTTGCTGTTATAAAGAGG + Intergenic
983280566 4:165676311-165676333 CCCAATTTGCTGGAATTAAGAGG - Intergenic
983461117 4:168027036-168027058 ACCAATTTAGAGTAATTAAGAGG + Intergenic
984227448 4:177052163-177052185 ACCAACCTCCTGTTATTAATAGG - Intergenic
984663050 4:182394504-182394526 ACCACATTTCAGTTATTAAGAGG - Intronic
984664465 4:182410581-182410603 ACCACATTGCTGTAATTAATAGG + Intronic
986303642 5:6499263-6499285 ATCAAGTTTATGTAATTAATGGG - Intergenic
987617400 5:20294199-20294221 AACTACTTTGGGTAATTAAGAGG - Intronic
991066552 5:62430620-62430642 AACTACTTTCTGAGATTAAGGGG - Intronic
993682949 5:90902228-90902250 AACCATTTTCTGTTATTAAGTGG + Intronic
994679404 5:102866263-102866285 GCCCACTTTCTGTCTTTAAGAGG + Exonic
994918826 5:106015381-106015403 ACCAATTTTCAGTAAATCAGAGG - Intergenic
995705180 5:114981394-114981416 TCACACTTTCTGTAATTTAGGGG + Intergenic
996853596 5:127979794-127979816 ATCAACTTCCTGAAATTAAGGGG + Intergenic
1000800185 5:165716027-165716049 AGCAACTTTCTATAAATTAGTGG - Intergenic
1001027862 5:168239208-168239230 ATCAAATTTCTTTAATTATGAGG - Intronic
1003689516 6:8338912-8338934 TCCAACTTTCGGTAATGAATAGG - Intergenic
1003756995 6:9132882-9132904 ACTACCTTACTGTAATTATGTGG - Intergenic
1009211520 6:60868719-60868741 TTCAACTTTGTGTAATAAAGTGG + Intergenic
1010622640 6:78095362-78095384 ACCAACTTTATTAAATTATGGGG - Intergenic
1014131825 6:117844112-117844134 AACAACTTTCTGTCATAGAGTGG - Intergenic
1015791097 6:136965283-136965305 CCCTACTTTCTGTAAATGAGTGG - Intergenic
1018414071 6:163586224-163586246 ACCACTTTTCAGTAATCAAGAGG + Intergenic
1021766479 7:23954898-23954920 ATCAACTGGCTGTAAATAAGTGG - Intergenic
1026399290 7:69993048-69993070 ACCAACCTCCTGAAATTCAGAGG - Intronic
1026554676 7:71396415-71396437 ATCAACTTACTGTAAATATGAGG + Intronic
1028010037 7:85630469-85630491 ATCAGCTTTATATAATTAAGTGG + Intergenic
1029484459 7:100830933-100830955 ACCCACGTTCTGTAATTTAGTGG - Intronic
1039466709 8:37789713-37789735 ACAAAATTTTTGTAATTAACCGG + Intronic
1041773440 8:61497544-61497566 ACTAACTTTGAGTAAGTAAGTGG - Intronic
1042918379 8:73897479-73897501 ACCAACTGACTGTAAATCAGGGG - Intergenic
1043151247 8:76718865-76718887 ATCAAGCTGCTGTAATTAAGGGG - Intronic
1043869217 8:85412593-85412615 ACCAACTCTCAAAAATTAAGAGG + Intronic
1045310336 8:100995333-100995355 ATCACCTTTCTGAAATTAATAGG - Intergenic
1047614489 8:126552038-126552060 ACCCATTTTCTGTAATTATGTGG + Intergenic
1050472842 9:6010048-6010070 AACAACTTTCTTAAACTAAGAGG - Intergenic
1052456809 9:28710097-28710119 ACCAACATTATGATATTAAGAGG + Intergenic
1056448975 9:86696448-86696470 ACCACATTTCTGTATTTCAGGGG - Intergenic
1056625081 9:88246190-88246212 ACCAACTGGCTGTAAATCAGGGG - Intergenic
1058393368 9:104522327-104522349 ACCAACTTTTTGTAAAGCAGTGG + Intergenic
1186010082 X:5120418-5120440 TCCAAATTTCTGTAATTGACAGG + Intergenic
1187210048 X:17221102-17221124 CCCAAGTTTCTGTTATTAAAAGG - Intergenic
1194639409 X:96384889-96384911 ACCAACTTTCTGGAAAAAAATGG - Intergenic
1196646724 X:118125982-118126004 ACCAAAATTCTGTATTTAGGCGG - Intergenic
1197233278 X:124029696-124029718 GCCAACTTTCTGTAAAGAACTGG - Intronic
1201669699 Y:16505287-16505309 TCCAAATTTCTGTAATTGACAGG - Intergenic
1202378221 Y:24256884-24256906 AGCATCTTTCTGGAATTAACAGG - Intergenic
1202492561 Y:25413237-25413259 AGCATCTTTCTGGAATTAACAGG + Intergenic