ID: 978029168

View in Genome Browser
Species Human (GRCh38)
Location 4:103917160-103917182
Sequence ATTCACATGGGGAATAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978029168_978029175 23 Left 978029168 4:103917160-103917182 CCTTCTCTATTCCCCATGTGAAT No data
Right 978029175 4:103917206-103917228 GACATTTGTCATTGTATTTAGGG No data
978029168_978029174 22 Left 978029168 4:103917160-103917182 CCTTCTCTATTCCCCATGTGAAT No data
Right 978029174 4:103917205-103917227 AGACATTTGTCATTGTATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978029168 Original CRISPR ATTCACATGGGGAATAGAGA AGG (reversed) Intergenic
No off target data available for this crispr