ID: 978051963

View in Genome Browser
Species Human (GRCh38)
Location 4:104212154-104212176
Sequence CTGTGGGTATGTAGTATAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978051963_978051970 9 Left 978051963 4:104212154-104212176 CCCACTATACTACATACCCACAG No data
Right 978051970 4:104212186-104212208 CTATCAACATCCTGTATCACAGG No data
978051963_978051972 11 Left 978051963 4:104212154-104212176 CCCACTATACTACATACCCACAG No data
Right 978051972 4:104212188-104212210 ATCAACATCCTGTATCACAGGGG No data
978051963_978051971 10 Left 978051963 4:104212154-104212176 CCCACTATACTACATACCCACAG No data
Right 978051971 4:104212187-104212209 TATCAACATCCTGTATCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978051963 Original CRISPR CTGTGGGTATGTAGTATAGT GGG (reversed) Intergenic
No off target data available for this crispr