ID: 978052110

View in Genome Browser
Species Human (GRCh38)
Location 4:104214191-104214213
Sequence TGGGACTACTTTGAAAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978052110_978052113 11 Left 978052110 4:104214191-104214213 CCAGTCTTTTCAAAGTAGTCCCA No data
Right 978052113 4:104214225-104214247 GAGTACTCAGATATCTGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978052110 Original CRISPR TGGGACTACTTTGAAAAGAC TGG (reversed) Intergenic
No off target data available for this crispr