ID: 978054782

View in Genome Browser
Species Human (GRCh38)
Location 4:104249661-104249683
Sequence CCTCTTCTGCAGGAGCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978054777_978054782 -9 Left 978054777 4:104249647-104249669 CCCTGTTCAAGTCACCTCTTCTG No data
Right 978054782 4:104249661-104249683 CCTCTTCTGCAGGAGCTGCTGGG No data
978054776_978054782 -5 Left 978054776 4:104249643-104249665 CCTTCCCTGTTCAAGTCACCTCT No data
Right 978054782 4:104249661-104249683 CCTCTTCTGCAGGAGCTGCTGGG No data
978054778_978054782 -10 Left 978054778 4:104249648-104249670 CCTGTTCAAGTCACCTCTTCTGC No data
Right 978054782 4:104249661-104249683 CCTCTTCTGCAGGAGCTGCTGGG No data
978054775_978054782 0 Left 978054775 4:104249638-104249660 CCACTCCTTCCCTGTTCAAGTCA No data
Right 978054782 4:104249661-104249683 CCTCTTCTGCAGGAGCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978054782 Original CRISPR CCTCTTCTGCAGGAGCTGCT GGG Intergenic
No off target data available for this crispr