ID: 978061401

View in Genome Browser
Species Human (GRCh38)
Location 4:104344744-104344766
Sequence CCGTGGCTCTCTCTAGATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978061394_978061401 -9 Left 978061394 4:104344730-104344752 CCAGCCCCCTGCCACCGTGGCTC No data
Right 978061401 4:104344744-104344766 CCGTGGCTCTCTCTAGATTTTGG No data
978061392_978061401 26 Left 978061392 4:104344695-104344717 CCAGGTGTGTACACACTCAGGGC No data
Right 978061401 4:104344744-104344766 CCGTGGCTCTCTCTAGATTTTGG No data
978061389_978061401 30 Left 978061389 4:104344691-104344713 CCAGCCAGGTGTGTACACACTCA No data
Right 978061401 4:104344744-104344766 CCGTGGCTCTCTCTAGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978061401 Original CRISPR CCGTGGCTCTCTCTAGATTT TGG Intergenic
No off target data available for this crispr