ID: 978072626

View in Genome Browser
Species Human (GRCh38)
Location 4:104491565-104491587
Sequence CAGCAGCGCCGCCGCCGCCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 543
Summary {0: 1, 1: 0, 2: 14, 3: 58, 4: 470}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978072626_978072634 -7 Left 978072626 4:104491565-104491587 CCGCGGCGGCGGCGGCGCTGCTG 0: 1
1: 0
2: 14
3: 58
4: 470
Right 978072634 4:104491581-104491603 GCTGCTGGGGAAGATGGGGGTGG 0: 1
1: 0
2: 12
3: 184
4: 3206
978072626_978072636 21 Left 978072626 4:104491565-104491587 CCGCGGCGGCGGCGGCGCTGCTG 0: 1
1: 0
2: 14
3: 58
4: 470
Right 978072636 4:104491609-104491631 CGCGCGATCTTGGCCGCCTGTGG 0: 1
1: 0
2: 0
3: 2
4: 40
978072626_978072637 22 Left 978072626 4:104491565-104491587 CCGCGGCGGCGGCGGCGCTGCTG 0: 1
1: 0
2: 14
3: 58
4: 470
Right 978072637 4:104491610-104491632 GCGCGATCTTGGCCGCCTGTGGG 0: 1
1: 0
2: 0
3: 3
4: 98
978072626_978072635 11 Left 978072626 4:104491565-104491587 CCGCGGCGGCGGCGGCGCTGCTG 0: 1
1: 0
2: 14
3: 58
4: 470
Right 978072635 4:104491599-104491621 GGTGGTGATGCGCGCGATCTTGG 0: 1
1: 0
2: 0
3: 2
4: 33
978072626_978072638 26 Left 978072626 4:104491565-104491587 CCGCGGCGGCGGCGGCGCTGCTG 0: 1
1: 0
2: 14
3: 58
4: 470
Right 978072638 4:104491614-104491636 GATCTTGGCCGCCTGTGGGAAGG 0: 1
1: 0
2: 0
3: 13
4: 78
978072626_978072633 -10 Left 978072626 4:104491565-104491587 CCGCGGCGGCGGCGGCGCTGCTG 0: 1
1: 0
2: 14
3: 58
4: 470
Right 978072633 4:104491578-104491600 GGCGCTGCTGGGGAAGATGGGGG 0: 1
1: 0
2: 2
3: 50
4: 517

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978072626 Original CRISPR CAGCAGCGCCGCCGCCGCCG CGG (reversed) Exonic
900205015 1:1427937-1427959 CCGCAGCCCCGCCCCCGCCACGG + Intergenic
900364806 1:2306781-2306803 CCGCAGCGCCGCCGACAACGCGG + Exonic
900483702 1:2911398-2911420 CAGCAGCGCCGCGGCGGCCGCGG - Intergenic
901805494 1:11736168-11736190 CACCTGCGCCGCAGCCGCGGGGG - Exonic
902856522 1:19210198-19210220 CGGCAGCGGCTCCGGCGCCGGGG - Exonic
903263534 1:22143412-22143434 CAGCTGCCCGGCCGCCGCCCGGG + Intronic
903504718 1:23825319-23825341 CTGCAGGGCCGCCGCCTCGGCGG + Intronic
903514737 1:23902841-23902863 CAGCAACGCCGGCGCCGCCGTGG - Intronic
903907290 1:26696160-26696182 CAGCTGAGCCGCCGGCGCCTCGG + Exonic
903925125 1:26826605-26826627 CCGCAGCGCCCCCTCCGCCTGGG - Intergenic
904252951 1:29237747-29237769 CCGCAGCCCCGGCGCCGCCTCGG - Intronic
904567256 1:31435217-31435239 CAGCAGCCCCGCGGCTGCCGTGG - Intergenic
904620453 1:31772032-31772054 CCGCGCCGCCGCCGCCGCCACGG - Intergenic
904641988 1:31938059-31938081 CGCCGCCGCCGCCGCCGCCGAGG - Exonic
904782932 1:32964389-32964411 AGGCTCCGCCGCCGCCGCCGCGG + Exonic
905399697 1:37692354-37692376 CAGCGAGGCCGCCGCCGTCGCGG - Intergenic
905449285 1:38046642-38046664 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
906204395 1:43979335-43979357 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
906627023 1:47333822-47333844 CCGCCGCGGCCCCGCCGCCGTGG - Exonic
906960920 1:50419099-50419121 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
910935062 1:92480724-92480746 CAGCAAGCCCGCCGCTGCCGTGG + Exonic
912514838 1:110211013-110211035 CTGCTGCGCTGCCGCCGCTGCGG + Intergenic
914044260 1:144077800-144077822 TTGCATCCCCGCCGCCGCCGTGG + Intergenic
914286155 1:146228794-146228816 CTCCTCCGCCGCCGCCGCCGCGG + Exonic
915246348 1:154558628-154558650 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
916065505 1:161132641-161132663 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
917904608 1:179576090-179576112 CTTCAGCGCCGCCCCGGCCGTGG - Intergenic
918015957 1:180632460-180632482 CCGCAGCCCCGCTGCCGCCGGGG + Intronic
919097958 1:193059640-193059662 CAACAGCCCCACTGCCGCCGGGG - Intronic
920260538 1:204685270-204685292 GGGCAGCGCCGCCGCCGCCGGGG - Intronic
920352168 1:205344302-205344324 GAGAAGCGGAGCCGCCGCCGGGG + Exonic
920805779 1:209232055-209232077 CAGCTGGGCCGGCGCCGCCGGGG + Intergenic
921945702 1:220884599-220884621 CCGAGGCGCCGCCGCCGCCAAGG - Exonic
923163476 1:231337777-231337799 TATCGGCGCCGCAGCCGCCGCGG + Exonic
923490311 1:234478531-234478553 CACCAGCGCCGCCGCGTCCTCGG + Exonic
923630869 1:235649157-235649179 CAGCAGCCCAGACGCCGCCTCGG - Intronic
924754786 1:246931492-246931514 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1062910169 10:1206955-1206977 CAGCAGCCCCGCTGCCTTCGCGG - Intronic
1064086883 10:12351638-12351660 CAGCAGCCCCGCCACTGCAGAGG - Intronic
1064443172 10:15371242-15371264 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1064712435 10:18140768-18140790 CGCCACCGCCGCCGCCGCTGTGG - Exonic
1066429338 10:35336877-35336899 CAGCAGCGGCGGCGGCGGCGGGG - Exonic
1070800837 10:79243560-79243582 CCGCGCCGCCGCCGCCGCCGGGG + Intronic
1071997519 10:91162877-91162899 CAGCGCCGCCGCCGCCGCCGCGG + Intergenic
1071997722 10:91163507-91163529 CAGCAGCGGCGCCTCCGCCGAGG + Intronic
1071997723 10:91163510-91163532 CAGCGGCGCCTCCGCCGAGGAGG + Intronic
1072654322 10:97319716-97319738 CAGCAGCAGCGGCACCGCCGGGG - Exonic
1072656562 10:97334288-97334310 CAGCAGCAGCGGCACCGCCGGGG + Exonic
1073099604 10:100999792-100999814 CAGCCCCGCCTCCGCCTCCGCGG - Exonic
1073414265 10:103368210-103368232 CACCGGGGCCGCCCCCGCCGGGG - Exonic
1074995494 10:118754462-118754484 CTGCGACGCGGCCGCCGCCGTGG - Exonic
1075032131 10:119030397-119030419 CAGCCGGGCGGCCGCCGCCCCGG - Exonic
1075430297 10:122374766-122374788 CACCCGCGCCGCCGCGGCCCCGG - Exonic
1076638912 10:131901018-131901040 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
1076706015 10:132301974-132301996 CAGCAGCGCTGGCACCGCCTGGG + Intronic
1076707031 10:132307785-132307807 CAGCAGCGCCGCGGCGTCCCCGG - Exonic
1076880462 10:133237106-133237128 CACCAGTCCCGCCGCCGACGCGG + Intergenic
1076881084 10:133239522-133239544 CAGCACCCCCGCCGCCTCCCAGG - Intronic
1077214546 11:1389998-1390020 CGCCGCCGCCGCCGCCGCCGAGG - Intronic
1078139856 11:8684022-8684044 CAGCATTACCGCGGCCGCCGGGG - Exonic
1078544750 11:12239277-12239299 CAGCAGGGCCACCCCCGCAGAGG - Intronic
1078659824 11:13277857-13277879 ACTCACCGCCGCCGCCGCCGCGG + Exonic
1078801059 11:14644271-14644293 GAGCAGCGCCGCGGCTGCTGGGG - Exonic
1079128502 11:17734838-17734860 CAGCAGCGTCGCGGCGGCGGCGG + Exonic
1079689405 11:23403534-23403556 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1082986080 11:59172361-59172383 GCGCGCCGCCGCCGCCGCCGGGG - Intronic
1083322216 11:61854767-61854789 CAGCAGAGCCGCTGCAGCTGAGG + Intronic
1083623650 11:64060936-64060958 CCCCGCCGCCGCCGCCGCCGCGG - Intronic
1083674577 11:64318353-64318375 CAGCAGAGCCGCTGCAGCCATGG + Exonic
1083922315 11:65787507-65787529 CCGCAGCCTCGACGCCGCCGCGG - Intronic
1083970302 11:66070403-66070425 CGCCCCCGCCGCCGCCGCCGCGG + Intronic
1084000152 11:66291782-66291804 CGGCGGCGCCGCCGGTGCCGCGG + Intergenic
1085043969 11:73342943-73342965 CAGCAGCGCCGCCGGCGGCCGGG + Intronic
1085123604 11:73982850-73982872 AAGCCGCGCCGCCGCCTGCGCGG - Exonic
1085205830 11:74731362-74731384 CAGCAGCGGCGGCGGCGCGGCGG + Intronic
1085295662 11:75430318-75430340 GGCCAGCGCCGCCGCCGCCCCGG + Exonic
1086887838 11:92224978-92225000 CGCCGCCGCCGCCGCCGCCGGGG - Intergenic
1089563237 11:119356481-119356503 CCGCAGCGCCCGCGCCTCCGAGG - Exonic
1089729555 11:120511819-120511841 CAGCAGCCCCGCGGCCGGCCCGG + Exonic
1090003990 11:122984317-122984339 CAGCCGCCCCGCCTCTGCCGGGG + Intergenic
1090699312 11:129279630-129279652 GAGGCGCGCCGCCGCGGCCGCGG + Intergenic
1091335338 11:134762206-134762228 CAGCAGCGCAGACGCCGCCGGGG + Intergenic
1091823164 12:3491292-3491314 GACCGCCGCCGCCGCCGCCGCGG + Exonic
1091874669 12:3924106-3924128 CAGCACCACGGCCGCCCCCGTGG - Intergenic
1093464976 12:19439851-19439873 CAGCAGCGCCGCCACCGCCTCGG - Exonic
1094025804 12:25958832-25958854 CCCCAGCGCCAACGCCGCCGCGG - Intergenic
1094199148 12:27779883-27779905 CAGCTGCGCGTCCGCAGCCGAGG + Intergenic
1095271475 12:40224691-40224713 CGGCCGCGCCGCCGCTGCGGTGG + Intronic
1096500692 12:52062417-52062439 CAGCAGCTCCGCTGCTGCAGAGG + Intergenic
1096771731 12:53939655-53939677 CCCGAGCGCCGCCGCCGCCGGGG + Intronic
1096788917 12:54033347-54033369 CTGCAGCGCCGCGGCCGCTCCGG + Exonic
1096983740 12:55743399-55743421 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1097007830 12:55931791-55931813 AAGCAGAGCTGCCGCCGGCGCGG + Intronic
1097232859 12:57522866-57522888 AAGCGCCGCTGCCGCCGCCGCGG - Exonic
1097264420 12:57737514-57737536 CGCCACCGCCGCCGCCGCCGGGG - Exonic
1097989927 12:65824205-65824227 CCCGGGCGCCGCCGCCGCCGAGG + Exonic
1100444814 12:94650579-94650601 GCCCTGCGCCGCCGCCGCCGCGG + Intergenic
1101340882 12:103841130-103841152 CACCACCGCCGCCGCTGCCATGG + Exonic
1101371884 12:104138027-104138049 CGCCAACGCCGCCGCGGCCGGGG - Intronic
1101466923 12:104958361-104958383 GCGCAGCCGCGCCGCCGCCGGGG + Intronic
1101592898 12:106139193-106139215 CGCCGCCGCCGCCGCCGCCGTGG - Exonic
1101605885 12:106247623-106247645 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1102254057 12:111406026-111406048 CCCCCGGGCCGCCGCCGCCGGGG - Exonic
1102370948 12:112382090-112382112 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1102853864 12:116277234-116277256 CCGGGCCGCCGCCGCCGCCGGGG + Exonic
1102853961 12:116277514-116277536 CCTCGGAGCCGCCGCCGCCGCGG + Intergenic
1103433026 12:120904104-120904126 CGGAGCCGCCGCCGCCGCCGCGG - Exonic
1103649635 12:122422628-122422650 GTGACGCGCCGCCGCCGCCGCGG + Intronic
1103954250 12:124567588-124567610 CACCGCCGCCGCGGCCGCCGGGG - Intronic
1104049562 12:125186488-125186510 CCCCGCCGCCGCCGCCGCCGCGG - Intergenic
1104376284 12:128267422-128267444 CAGCGGCGCCGCCGGCCCGGGGG - Exonic
1104676510 12:130715294-130715316 CAGCACCCCCGCCTCCCCCGGGG + Intronic
1104918260 12:132277651-132277673 CAGCAGAGCCGGGGCCGCGGGGG - Intronic
1105850300 13:24328330-24328352 CTGCCGCGCCGCCTCTGCCGCGG + Intergenic
1105943640 13:25171580-25171602 TGACAGCCCCGCCGCCGCCGCGG + Exonic
1106208405 13:27620500-27620522 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
1106512389 13:30422371-30422393 CACCACCGCCGCCGCGGCCAGGG - Intergenic
1106683429 13:32031520-32031542 CAGCGCGGCCGCCGCCTCCGAGG + Exonic
1107276706 13:38687409-38687431 CAGGACCGCCACCGCCGCCCCGG + Exonic
1107548961 13:41457728-41457750 GGGCAGCCCCGCGGCCGCCGCGG + Exonic
1108227457 13:48303945-48303967 CACCGCCGCCGCTGCCGCCGCGG + Exonic
1108314094 13:49221008-49221030 GAACAGCGCCGCGGCCTCCGCGG - Exonic
1110596556 13:77326662-77326684 GAACAGCGCCCCCGGCGCCGGGG + Exonic
1112365484 13:98752363-98752385 CAGAGGCGCCGACTCCGCCGAGG - Intronic
1113379060 13:109786486-109786508 CAGCAGCCCCGGCGGCGGCGCGG - Exonic
1113874466 13:113585348-113585370 CAGCCGGGCGGGCGCCGCCGGGG + Intronic
1115752330 14:36505501-36505523 CAGCCGCGGCTCCGCCGTCGGGG - Intronic
1116817862 14:49599795-49599817 CCGCGGCGCTGCCGCCGCCGCGG - Intronic
1116905093 14:50396643-50396665 AAGCCTCGCCGCCGCCTCCGCGG - Intronic
1118351002 14:64972369-64972391 CTGCGCCGCCGCCGCCGCCCCGG + Intronic
1118607700 14:67515405-67515427 CGCCGCCGCCGCCGCCGCCGGGG - Intronic
1118849479 14:69573085-69573107 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1119249037 14:73136551-73136573 CCGCCGCCCCGCTGCCGCCGCGG - Exonic
1119484916 14:74980924-74980946 CCGCGCCGCCGCCGCCACCGTGG - Intergenic
1119520130 14:75279033-75279055 CAGCAGCGCGTCCCCGGCCGGGG + Exonic
1122220976 14:100239065-100239087 GGGAAGCCCCGCCGCCGCCGCGG + Exonic
1122268413 14:100557363-100557385 TAGCAGGGCAGCCGCCGCCATGG - Intronic
1122444991 14:101761696-101761718 CGCCGCCGCCGCCGCCGCCGTGG + Intergenic
1122445030 14:101761819-101761841 CAGCAGCAGCGCCCCCGCCCCGG - Exonic
1122657923 14:103274194-103274216 CAGCAGCCCCGCAGCAGCCCCGG + Intergenic
1122878063 14:104677923-104677945 CAGCACCGCAGCTGCCGCCTCGG + Intergenic
1122993283 14:105248924-105248946 CAGCAACGCCGGCGCCGCCGTGG + Exonic
1123024887 14:105419881-105419903 CGCCGCCGCCGCCGCCGCCGAGG - Exonic
1124527582 15:30471288-30471310 CGGTGGCGCCGCCGCAGCCGTGG - Intergenic
1124771077 15:32536414-32536436 CGGTGGCGCCGCCGCAGCCGTGG + Intergenic
1125200754 15:37099072-37099094 CTGCTGCGCCGCTGCCGCCGTGG - Intronic
1125508788 15:40282031-40282053 CCGCGCCGCCGCCGCCGCTGCGG - Exonic
1125522938 15:40358259-40358281 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1126697989 15:51341740-51341762 GAGCAGCGCCACGGCCGCCAGGG - Exonic
1128119232 15:65133547-65133569 CGCCAGCGCCGCCTCCGCCGCGG + Exonic
1128482767 15:68054386-68054408 CAGCAGCGGCGCCGTCTCCGCGG - Intronic
1129983713 15:79897297-79897319 CAGTGGCGCTGCCGCCTCCGCGG - Intronic
1130348015 15:83066896-83066918 TCGCGGCGCCGCCGCCGCTGGGG - Exonic
1131108747 15:89751228-89751250 CAGACGCGCCGCCGCTGCCATGG - Exonic
1131257554 15:90872032-90872054 CAGCCTCCCCGCCGCCACCGGGG + Intronic
1131735473 15:95326959-95326981 GCGGAGCGCCGCAGCCGCCGCGG - Intergenic
1132055674 15:98648984-98649006 CCTCAGCGCCGCCGCCGCCGCGG - Exonic
1132365126 15:101251565-101251587 GGGCAGCGCCGCCGCCGCCGCGG + Exonic
1132519750 16:381759-381781 CAGCGGCCCCGCCACCACCGCGG + Exonic
1132585806 16:705395-705417 GGGCCGCGCCGCCGCCGCCCGGG - Intronic
1132641876 16:981780-981802 CGCCGCCGCCGCCGCCGCCGAGG - Intergenic
1133156559 16:3880444-3880466 CGGGGTCGCCGCCGCCGCCGCGG + Exonic
1133334900 16:5000715-5000737 CAGCAGCGCCTCCTCCCCCACGG - Exonic
1133464737 16:6018967-6018989 CGCCAGCGCCGCCGCCGCCGCGG - Intergenic
1134143632 16:11742848-11742870 CGTCAGCCGCGCCGCCGCCGCGG + Exonic
1136626353 16:31464550-31464572 CAGCCCCGCCGCCGCCATCGAGG + Exonic
1137531527 16:49281569-49281591 CAGCTCCGCCGCCGCCGCTCTGG + Exonic
1138425961 16:56932226-56932248 CGACACCGCCGCCGCCGCCATGG + Exonic
1138478289 16:57284712-57284734 CGGCTCCGCCCCCGCCGCCGGGG + Intergenic
1139364826 16:66427039-66427061 CGGGAGCCGCGCCGCCGCCGAGG + Intergenic
1139364829 16:66427042-66427064 GAGCCGCGCCGCCGCCGAGGGGG + Intergenic
1139448673 16:67014075-67014097 ACGCAGCGCTGCCTCCGCCGCGG + Intergenic
1139637121 16:68264524-68264546 CGGTCGCGCCGCCGCCGCCGCGG - Intronic
1140209183 16:72957815-72957837 CACCGCCGCCGCCGCCGCCCCGG + Exonic
1142395347 16:89828565-89828587 CAGCTGCGGCGGCGCCGCGGCGG + Exonic
1143099879 17:4499111-4499133 GAGCGGCGGCGCCGGCGCCGGGG + Exonic
1146371121 17:32266099-32266121 CTGGAGCGGCGCGGCCGCCGCGG + Intergenic
1146895050 17:36534920-36534942 TAGCAGTGCCGCAGCCGACGGGG - Exonic
1147139659 17:38453962-38453984 CACCAGCTCCGCGGCCGGCGGGG - Intronic
1147720441 17:42536470-42536492 GCGCCGCGCCGCCGCCGCCCAGG - Exonic
1148021807 17:44558234-44558256 GGGGAGCGCCGCCGCCGCCCGGG - Exonic
1148733383 17:49851251-49851273 CCGCAGCCCACCCGCCGCCGGGG - Intergenic
1148878572 17:50707714-50707736 CAGCGCCGCCGCCGTCGCCGCGG + Exonic
1149270113 17:54968428-54968450 CAGCATTGCAGCCGCCGCGGCGG - Exonic
1149461539 17:56833694-56833716 TGCCGGCGCCGCCGCCGCCGGGG - Exonic
1150003656 17:61456649-61456671 CGTCGTCGCCGCCGCCGCCGCGG + Exonic
1150267884 17:63842608-63842630 CAGCCACGGCGCCGCCGCCAGGG + Exonic
1151156102 17:72123820-72123842 CAGCAGCACCGCGGCCACCCCGG + Exonic
1151478543 17:74356878-74356900 CAGCAGCGGCGGCGACGCGGCGG - Exonic
1152049235 17:77959235-77959257 CGGAGCCGCCGCCGCCGCCGGGG + Intergenic
1152162361 17:78676792-78676814 CAGCAGCGCAGGCCGCGCCGCGG + Intronic
1152190203 17:78883542-78883564 CAGAAGCGCAGCCTCAGCCGGGG + Intronic
1152354147 17:79798467-79798489 CCCCAGCGCCGCCCCCGCCACGG - Intronic
1152468089 17:80476812-80476834 CAGCAGCGCCGGCCCAGGCGGGG - Intronic
1152748432 17:82051698-82051720 CAGCAGCGCGGCCAGGGCCGCGG + Exonic
1153040816 18:812015-812037 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1154173773 18:12068425-12068447 CCGCGCCGCCGCCGCCGCCGGGG + Intergenic
1154268212 18:12897117-12897139 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1155461583 18:26090387-26090409 CAGCAGGCCCGCCTCCGCCTCGG + Intronic
1157752711 18:50193837-50193859 CGGCAGCGCTGCAGCCGCCCGGG - Intronic
1157867049 18:51196763-51196785 CACCCCCGCCGCCGCCGCCGCGG + Exonic
1158436027 18:57435920-57435942 CAGCGGCGCCGCGGCCCGCGTGG - Exonic
1159511327 18:69401058-69401080 CTGCAGGGCCGCCGCGGACGGGG - Exonic
1160706306 19:531784-531806 CTGCGCCGCCGCCGCCGCCCGGG - Exonic
1160921798 19:1524145-1524167 CTGCGCCGCCGCCGCGGCCGGGG - Intronic
1160930702 19:1568310-1568332 CCGCGCCGCCGCCGCCGCCTCGG - Intergenic
1160991603 19:1862583-1862605 GAACCGCGTCGCCGCCGCCGGGG - Intronic
1161031897 19:2061447-2061469 CAGGCGCGCGGCCGCCGCCGGGG - Intergenic
1161069387 19:2252749-2252771 CATCAGCGCCGCCTGCGCCCCGG - Exonic
1161495562 19:4584190-4584212 CAGCAGCGCCCTCCCAGCCGTGG + Intergenic
1161973332 19:7595984-7596006 CCGCAGCCCCGGCGCCGCCATGG + Exonic
1162031156 19:7917773-7917795 CACCAGCGCCACCACCGGCGCGG - Exonic
1162421672 19:10568984-10569006 CTGCGCCGCCGCCGCCGCTGAGG + Intronic
1162751759 19:12833852-12833874 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1162830852 19:13283299-13283321 CAGCATCGCCCTGGCCGCCGAGG - Exonic
1163154474 19:15432492-15432514 CGCCACCGCCACCGCCGCCGCGG - Intronic
1163445151 19:17341588-17341610 CCGCAGCGCCTCTGCCGCCAGGG - Exonic
1163513076 19:17747711-17747733 CGGCAGCCGCGCCGCAGCCGCGG + Exonic
1163513077 19:17747714-17747736 CAGCCGCGCCGCAGCCGCGGAGG + Exonic
1163606979 19:18280983-18281005 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
1163668234 19:18612957-18612979 CATCAGCGCCACCGCAGCCATGG - Exonic
1163807252 19:19406450-19406472 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1163828855 19:19538342-19538364 CAGCAGCGACGCCATGGCCGGGG - Exonic
1164937344 19:32224562-32224584 CAGTTGCCCCGCCGCCGCCCGGG - Intergenic
1165157228 19:33796057-33796079 GAGGAGAGCAGCCGCCGCCGCGG - Intronic
1165278168 19:34772821-34772843 CACCAACGCCGGCGCCGCCATGG + Exonic
1165459601 19:35936686-35936708 CAGCCGGGACGCCGCCGCCCCGG + Intronic
1165803167 19:38565320-38565342 GAGCAGCGCCGCCACTGCGGTGG - Exonic
1166100361 19:40567985-40568007 CACCTGCTCCGCCGCCGCGGGGG - Exonic
1166361253 19:42253868-42253890 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
1166736946 19:45091584-45091606 TCGCAGCGCCGGCTCCGCCGAGG + Intronic
1167268232 19:48493819-48493841 GAGCAGCGCCGACGCGGACGCGG - Exonic
1167418812 19:49390855-49390877 CAGCAGCTGCGCCGCGGCAGGGG + Exonic
1167622690 19:50568130-50568152 CAGCCCCACCGCCGCCGCTGCGG - Intergenic
1168073073 19:53963343-53963365 CCGAGGCGCCGCCGCCCCCGCGG - Exonic
1168314130 19:55476713-55476735 CAGCTGCACCGCCGCTGCCGGGG + Exonic
1202683212 1_KI270712v1_random:29117-29139 CTTCTGCGCCCCCGCCGCCGAGG + Intergenic
1202683781 1_KI270712v1_random:31100-31122 TTGCATCCCCGCCGCCGCCGTGG + Intergenic
926154886 2:10448257-10448279 CAGCAGCTCCGGCGCCACCTCGG - Exonic
926268113 2:11344461-11344483 AAGTGGCGCCGCCACCGCCGCGG + Exonic
927472265 2:23385393-23385415 CCCCAGCCCCGCGGCCGCCGCGG + Exonic
927542741 2:23927206-23927228 CAGCTGCCCCGCCCCCGGCGCGG + Intergenic
927881457 2:26692709-26692731 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
928421261 2:31138885-31138907 CAGCAGCCCTGCCGGCGCCCTGG - Intronic
929604240 2:43224802-43224824 CAGCAGAGCGGCCGCAGCCGCGG + Exonic
929966847 2:46542851-46542873 CCGGGGCGCTGCCGCCGCCGCGG - Exonic
932621871 2:73269465-73269487 CGACGGCGCCGCCGCCGCCGCGG - Exonic
933666860 2:84971283-84971305 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
933666981 2:84971628-84971650 CCGCGGCGCCGCTGCCGCCACGG + Intronic
934247909 2:90323715-90323737 TTGCATCCCCGCCGCCGCCGTGG - Intergenic
934248016 2:90324088-90324110 CCCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248169 2:90324632-90324654 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248184 2:90324693-90324715 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248358 2:90325306-90325328 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248369 2:90325344-90325366 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248380 2:90325382-90325404 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248396 2:90325446-90325468 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934261467 2:91479094-91479116 TTGCATCCCCGCCGCCGCCGTGG + Intergenic
934296814 2:91749016-91749038 CACCCTCGCCGCCGCCGCCGCGG + Intergenic
934304465 2:91809922-91809944 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
934328792 2:92042828-92042850 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
935112318 2:100104804-100104826 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
935196646 2:100820245-100820267 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
935592441 2:104855292-104855314 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
935592782 2:104856389-104856411 CGCCGCCGCCGCCGCCGCCGTGG - Exonic
936126631 2:109794249-109794271 CTGGAGCGCCGACGTCGCCGAGG + Intronic
936218062 2:110577219-110577241 CTGGAGCGCCGACGTCGCCGAGG - Intergenic
936433184 2:112482010-112482032 CTGCGCCGCCGCCGCCCCCGGGG + Intergenic
937203953 2:120223859-120223881 CAAGAGCGCCGCTGCCGCCTGGG - Intergenic
939969667 2:148644971-148644993 CCGCCCCGCCGCCGCCGCCCGGG + Exonic
941119110 2:161507855-161507877 CCCCGCCGCCGCCGCCGCCGCGG + Intronic
941580696 2:167293121-167293143 CGGCAGCGCCGGCGGCGCGGCGG - Intergenic
942241115 2:173964682-173964704 CGCCGCCGCCGCCGCCGCCGGGG - Intronic
942446204 2:176080457-176080479 CAACAGCGCGGCCTCTGCCGCGG - Exonic
942678177 2:178450676-178450698 CAGCAGCGCCGCAGCCTCTCAGG + Intronic
942890493 2:180981011-180981033 CCCCACCGCCGCCGCCGCCCCGG - Intronic
943571506 2:189580771-189580793 CGCCGCCGCCGCCGCCGCCGTGG + Exonic
944831219 2:203535342-203535364 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
945466017 2:210171322-210171344 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
946354860 2:219178291-219178313 GGGCTGCGCGGCCGCCGCCGGGG - Exonic
946966440 2:225042281-225042303 CAGCGCCGCGTCCGCCGCCGCGG - Exonic
947506646 2:230713005-230713027 CAGCAGCGCGGCGGCAGCCGCGG + Exonic
947506658 2:230713050-230713072 CCGCGCAGCCGCCGCCGCCGCGG + Exonic
947800853 2:232927957-232927979 CTTCAGCGCCGCCTGCGCCGTGG - Intronic
947876134 2:233469433-233469455 CCGCAGCGCCCCCGCCGTCGAGG + Exonic
948216514 2:236237242-236237264 CAGCCCAGCCGCCGGCGCCGGGG - Intronic
948487251 2:238288752-238288774 CAGCGCCGCCGCCTCCGCCGCGG + Intronic
1168802629 20:653180-653202 CCCCATCGTCGCCGCCGCCGCGG + Exonic
1169171830 20:3471355-3471377 CACCGCCGCCGCCGCCGCCGCGG - Exonic
1169214727 20:3786510-3786532 CGGCGCCGCCGCCGCCGCCCCGG + Exonic
1171810657 20:29742810-29742832 CAACACCGCCGCCGCCATCGCGG + Intergenic
1171977590 20:31605405-31605427 CAGCACCGCCACCGCCGCCGCGG + Exonic
1172100891 20:32483564-32483586 CGGCAGCGGCGGCGGCGCCGCGG + Intronic
1172239266 20:33401403-33401425 GAGCAGCGCGGCCGCCGGGGTGG - Intronic
1173672875 20:44810298-44810320 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1173813584 20:45971272-45971294 CAGCGACGCCGCGGCCGCCCCGG - Exonic
1174100602 20:48123733-48123755 CAGCAGCACCGCTGCCTCCCTGG + Intergenic
1174153159 20:48500349-48500371 CAGCAGCACTGCCGCCTCCCTGG + Intergenic
1174153496 20:48502247-48502269 CAGCAGCACCGCTGCCTCCCTGG + Intergenic
1175036255 20:56004124-56004146 CAGCAGCACGGCCGGCACCGCGG + Exonic
1175517163 20:59577192-59577214 CAGCAGCGCTGGAGCCGCTGTGG - Intergenic
1175847000 20:62064788-62064810 CGGCTGCGGCGCCGGCGCCGGGG - Exonic
1176386061 21:6139038-6139060 CAGCAGCGCAGCCCATGCCGGGG - Intergenic
1176547620 21:8208472-8208494 CACCACCGCCGCCGCAGTCGCGG - Intergenic
1176548596 21:8212230-8212252 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176556251 21:8255724-8255746 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176556490 21:8256438-8256460 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176566571 21:8391519-8391541 CACCACCGCCGCCGCAGTCGCGG - Intergenic
1176567527 21:8395265-8395287 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176574447 21:8435706-8435728 CACCACCGCCGCCGCAGTCGCGG - Intergenic
1176575190 21:8438766-8438788 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176575429 21:8439480-8439502 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176611059 21:8986998-8987020 CACCACCGCCGCCGCAGTCGCGG - Intergenic
1177011053 21:15730366-15730388 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1178513837 21:33229905-33229927 GCGCCGCGCCGCCGCCGGCGCGG - Intronic
1178922506 21:36747851-36747873 CAGCTGCGCCGGCGCGCCCGGGG - Exonic
1178992246 21:37366296-37366318 CCGCAGCCCCGCCCGCGCCGGGG - Intronic
1179522547 21:41954236-41954258 CAGCCGCACAGCAGCCGCCGGGG - Intergenic
1179737412 21:43399214-43399236 CAGCAGCGCAGCCCATGCCGGGG + Intergenic
1179840852 21:44072342-44072364 CAGCAGCGGAGCCGCGGCAGAGG - Intronic
1180154951 21:45973209-45973231 CAGCCTCGCAGCCGCCTCCGGGG + Intergenic
1180733872 22:18001415-18001437 CCACAGCGACGCCGGCGCCGAGG - Intronic
1180871703 22:19150292-19150314 CGGCCGGGGCGCCGCCGCCGCGG + Intergenic
1180960724 22:19761143-19761165 CAGCTGCGCGGCCGCAGCCAAGG + Exonic
1181026853 22:20131825-20131847 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1181087707 22:20449957-20449979 AAGCGTCGCCGCCGCCGCCCCGG - Intronic
1181471344 22:23142036-23142058 CAGCAGCGTCCGCGGCGCCGCGG + Exonic
1182237005 22:28883818-28883840 CGCCTGCGCCGCCGCCCCCGCGG + Exonic
1182308624 22:29388693-29388715 TAGCAGCGCCGCGGCTGCCGAGG - Intronic
1182903725 22:33920047-33920069 CGGCGGCGCCGCCGCCTACGAGG + Exonic
1183683769 22:39350209-39350231 CCGCCGCCGCGCCGCCGCCGGGG - Intronic
1183720329 22:39558404-39558426 CCGCAGAGCCGCAGCCGCGGAGG - Intergenic
1183769487 22:39911808-39911830 CAGCAGCAACGGCACCGCCGGGG + Intronic
1184423413 22:44395143-44395165 CACCATCCGCGCCGCCGCCGTGG - Intergenic
1185055240 22:48575801-48575823 CCGCACCATCGCCGCCGCCGGGG - Intronic
1185374291 22:50474964-50474986 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1185397658 22:50600973-50600995 CCCCAGCCCCGCCGCCGGCGCGG + Intronic
1203238467 22_KI270732v1_random:30913-30935 CGCCGCCGCCGCCGCCGCCGGGG + Intergenic
1203252493 22_KI270733v1_random:124757-124779 CACCACCGCCGCCGCGGTCGCGG - Intergenic
1203253239 22_KI270733v1_random:127821-127843 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203253480 22_KI270733v1_random:128535-128557 CCGCGCCGCCGCCGACGCCGCGG + Intergenic
1203260550 22_KI270733v1_random:169843-169865 CACCACCGCCGCCGCAGTCGCGG - Intergenic
1203261294 22_KI270733v1_random:172902-172924 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203261534 22_KI270733v1_random:173613-173635 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
950729766 3:14947541-14947563 CAGCCTCGCCGCCGCGGCGGGGG - Intergenic
951217763 3:20040597-20040619 CCCCTGCGCCGCTGCCGCCGGGG + Exonic
951907896 3:27721913-27721935 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
952764813 3:36944830-36944852 CACCAGGACCGCCGCCGCCTGGG + Exonic
953947773 3:47164011-47164033 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
955911573 3:63863958-63863980 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
956659154 3:71582371-71582393 CGGCGCCGCCGCCACCGCCGTGG + Intronic
956678016 3:71753646-71753668 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
958900140 3:99876283-99876305 CTGCGCCGCCGCCGCGGCCGAGG - Intronic
959530731 3:107431535-107431557 GGTCACCGCCGCCGCCGCCGGGG + Intergenic
959920215 3:111860453-111860475 CAGCTGCGCCTCCGCCGCGCAGG - Intronic
961739986 3:129027247-129027269 GAGCACCGCCGCCGCCCGCGGGG - Intronic
962301863 3:134250565-134250587 CAGCAGCGGCGGCGGCGGCGGGG + Exonic
962318793 3:134374629-134374651 CAGCAGCGCCGCCTCCCCGGAGG - Intronic
963236695 3:142963434-142963456 CTGCAGCGACGCCCCCGGCGTGG - Exonic
963904455 3:150762657-150762679 CGGCCCCGCCGCCGCCGCCGGGG + Exonic
966182200 3:177197562-177197584 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
966201075 3:177359896-177359918 CGGCAGCGACCCCGACGCCGCGG + Intergenic
966724760 3:183099408-183099430 CAGCAGCACCGACACCGCAGAGG + Exonic
967904030 3:194486585-194486607 CCGCCGCGCCGCCTCCTCCGCGG + Intronic
968701299 4:2059400-2059422 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
968965362 4:3766614-3766636 CAGCGCCGCCGCCAGCGCCGGGG - Exonic
969113956 4:4859995-4860017 CCCCAGCGCCGCCGCGGCCACGG + Exonic
969414959 4:7052147-7052169 CAGCAGCCCCTCCGCAGCCTTGG + Intronic
969700135 4:8763331-8763353 CAGCAGCCCCTCAGCCGCCGAGG + Intergenic
970456350 4:16226993-16227015 GAGCCGGGCCCCCGCCGCCGCGG - Intronic
971457809 4:26860794-26860816 CTCCCGCGCCGCCGCCGCCGCGG - Intronic
972321553 4:37977360-37977382 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
973754932 4:54064858-54064880 CAGCGGAGCCGCCGCCCCCAGGG - Intronic
975166715 4:71186589-71186611 GAGCCGCGCCGCCTCCGCCGGGG - Intergenic
975870689 4:78776093-78776115 CCGTCGCGCCGCCGCCGCCCCGG - Intergenic
975985957 4:80202065-80202087 CACCGCCGCCGCCGCCCCCGTGG - Exonic
976146130 4:82044194-82044216 CAGCCCCTCCGCCGCAGCCGCGG - Intronic
978072626 4:104491565-104491587 CAGCAGCGCCGCCGCCGCCGCGG - Exonic
978529946 4:109703094-109703116 GAGTAGCGACGCCGGCGCCGGGG - Intronic
979547168 4:121951565-121951587 GAGCCGCAGCGCCGCCGCCGGGG - Exonic
980130362 4:128811616-128811638 CAGCTGCGCCGCCCGGGCCGGGG + Intronic
982712205 4:158768942-158768964 CCGCGCCGCCGCCGCCGCCGTGG + Intergenic
982745792 4:159103340-159103362 CCCCGGCGCCGGCGCCGCCGCGG - Intergenic
982745793 4:159103340-159103362 CCGCGGCGGCGCCGGCGCCGGGG + Intergenic
982745990 4:159104017-159104039 GCCCCGCGCCGCCGCCGCCGCGG + Intergenic
983143861 4:164188394-164188416 CAGCAGCATCGCCGCCACCAGGG - Intronic
983904752 4:173170236-173170258 CTGCAGCCCCGCCGCCTCGGCGG - Intronic
984462713 4:180058118-180058140 CAGCAGAGCCACTGCCGCCCTGG + Intergenic
984462995 4:180059167-180059189 GAGCGGAGCCGCCGCCGCCGCGG - Intergenic
984823625 4:183905820-183905842 GAGCAGCGCTGCCGCCGCGCGGG + Exonic
984973434 4:185209954-185209976 CAGCAGCAGCGGCGGCGCCGGGG + Intronic
985580285 5:692521-692543 CAGCAGCCCCGCCACTGCCCGGG + Intronic
985594941 5:783902-783924 CAGCAGCCCCGCCACTGCCCGGG + Intergenic
985749778 5:1667460-1667482 CAGGACCGCGGGCGCCGCCGGGG + Intergenic
986151127 5:5131304-5131326 CAGCAGCGCCTCAGCCACTGTGG - Intergenic
986330517 5:6713641-6713663 GTGGAACGCCGCCGCCGCCGCGG + Intergenic
986813660 5:11385161-11385183 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
987402336 5:17491371-17491393 CAGCTGGCCCGCCGCCTCCGTGG - Intergenic
988437531 5:31193807-31193829 CTCCGCCGCCGCCGCCGCCGCGG - Exonic
989576457 5:42992663-42992685 CAGCGCCGCCGCCGCCGCCCGGG - Intergenic
990210788 5:53480238-53480260 CGGCAGCGCCGGCGCGCCCGGGG - Intergenic
990545257 5:56815683-56815705 CAGCAGTCCCGCGGCAGCCGCGG - Exonic
990955144 5:61332803-61332825 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
991676558 5:69094291-69094313 CAAGGCCGCCGCCGCCGCCGGGG - Exonic
993457258 5:88141295-88141317 CAGGAGCGCGGGCGCGGCCGGGG + Intergenic
993901219 5:93585113-93585135 CGGCGCCGCCGCCGCCGCCGCGG - Exonic
994947723 5:106417264-106417286 CAGCAGCGCTGCAGCGGCAGCGG - Intergenic
996298570 5:121954208-121954230 CAGCGGCGCCGGCGCGGGCGCGG + Intergenic
996552418 5:124744452-124744474 CAGCACCTCTGCCGCCACCGCGG - Exonic
997402359 5:133612506-133612528 CTGCTGTGCCACCGCCGCCGCGG + Exonic
997975375 5:138438957-138438979 GGGGCGCGCCGCCGCCGCCGCGG + Intergenic
997990803 5:138543133-138543155 CCGCCGCGGAGCCGCCGCCGGGG - Exonic
997990809 5:138543147-138543169 CGTCAGAGCCGCCGCCGCCGCGG - Exonic
998435918 5:142108795-142108817 AAGCACCGCCGCCGCCGCCGAGG - Exonic
999293350 5:150441971-150441993 CAGCAGCCCAGCCGCCTCTGCGG + Intergenic
999315659 5:150582403-150582425 CACCAGGCCCGCCGCTGCCGCGG - Intergenic
999731717 5:154480171-154480193 CCGCAGAGCCGCCGCAGCAGCGG - Intergenic
1000220184 5:159208220-159208242 CAACCGGGCCGCCGCCGCCGCGG + Intronic
1001065072 5:168529582-168529604 CCGCGCCGCCGCCGCCGCCTCGG - Exonic
1001563228 5:172683647-172683669 CAGTAGCGCCGGCGACGACGCGG - Exonic
1002487634 5:179550578-179550600 CAGCAGCGCAGCCGCCTTCCCGG - Exonic
1002898194 6:1391018-1391040 CAGCAGCAACCCCGCCGCCTCGG + Exonic
1003175504 6:3750633-3750655 CAGCTGCGCCGCCTCCTCCCCGG - Intronic
1003206574 6:4018495-4018517 CAAGAGCGCCGCCGCCGGCAGGG + Intergenic
1003551833 6:7107683-7107705 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1003869406 6:10390302-10390324 CAGCCTCCCCGCCCCCGCCGGGG + Intergenic
1004044727 6:12012581-12012603 CAGCTGCAGCGCCCCCGCCGCGG - Intronic
1004193874 6:13487274-13487296 CGGCCGCGCCGCCGCAGCCCGGG + Exonic
1004561868 6:16760221-16760243 CCGCAGCGCCTCCTCCGCGGCGG + Intronic
1005705451 6:28447169-28447191 CAGCATTGCAGCCGCCGCGGCGG + Intergenic
1005955318 6:30659572-30659594 CAGGATCGCTGCCGCCGCCTGGG - Exonic
1006472662 6:34237336-34237358 CCCCTCCGCCGCCGCCGCCGCGG - Intronic
1007491740 6:42228513-42228535 CAGCAGCCCCGGCGCCCCCACGG + Exonic
1007590675 6:43018910-43018932 CAGCAGCACTGGCGCCGGCGGGG - Exonic
1007630308 6:43269753-43269775 CCGAGGAGCCGCCGCCGCCGGGG - Intronic
1007902048 6:45422034-45422056 CTCCCGCGCCGCCGCCTCCGCGG - Intronic
1008932467 6:56954927-56954949 GAGGAGCAGCGCCGCCGCCGCGG + Intergenic
1010107082 6:72182664-72182686 CGGCAGCGCCGCGCCCGCCTCGG - Exonic
1012399998 6:98835071-98835093 CGCCCCCGCCGCCGCCGCCGTGG - Exonic
1013170819 6:107635022-107635044 CACGCGCGGCGCCGCCGCCGAGG + Exonic
1013836548 6:114342201-114342223 CGCCCGCGCCGCCACCGCCGGGG - Exonic
1014116825 6:117675790-117675812 CTGCCGCGCCGCCTCTGCCGCGG + Exonic
1017337807 6:153282628-153282650 CAGCATTACCGCGGCCGCCGGGG + Intergenic
1017672242 6:156778733-156778755 CGCCTCCGCCGCCGCCGCCGGGG + Exonic
1018613007 6:165662037-165662059 CAGCTTCGCCCTCGCCGCCGCGG - Exonic
1019111974 6:169724109-169724131 CAGCGCCGCCGCCACCGCCATGG + Intronic
1019381651 7:727278-727300 CTGCAGCTGCGCCGCCGCCCTGG + Exonic
1019472877 7:1230425-1230447 CCGCGGCGCCGCCGCAGCCGAGG + Intergenic
1019474246 7:1236431-1236453 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1019708409 7:2507323-2507345 CAGCAGCTCAGCCGGCCCCGGGG + Intergenic
1020046706 7:5046058-5046080 CCCCAGCGCCGCCGGCTCCGGGG - Exonic
1021451298 7:20785514-20785536 CACCAGGGCCGCGGCAGCCGCGG + Exonic
1021704285 7:23351470-23351492 CAGCAGCCCCGAGGTCGCCGGGG - Exonic
1022427951 7:30285543-30285565 CGGCGGCGCCGCGGCGGCCGCGG + Exonic
1023064845 7:36367029-36367051 CCGCCGCGCCCCCGCCACCGAGG - Intronic
1023529350 7:41136726-41136748 CACCAGCACCCCCGCCGCCTCGG - Intergenic
1024043765 7:45574291-45574313 TCGCAGCGCGGTCGCCGCCGAGG + Intronic
1025069681 7:55887599-55887621 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1025233938 7:57220956-57220978 CAGCAGCACCGCCGCCTCCCTGG - Intergenic
1025615709 7:63114426-63114448 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1026923782 7:74174705-74174727 CATCGGCGCCGCCGCGGCCAAGG - Intronic
1027116569 7:75486080-75486102 CCCCAGCGCCGCCGGCTCCGGGG + Exonic
1027121895 7:75527901-75527923 CCCCAGCGCCGCCGACTCCGGGG + Intergenic
1027275232 7:76549530-76549552 CCCCAGCGCCGCCGGCTCCGGGG - Intergenic
1027960507 7:84940020-84940042 CAGCAGCGGCGCCTCCTCCGGGG + Intergenic
1028567136 7:92245972-92245994 CAGCAGCCCGGCCGCCGACCCGG - Exonic
1028871136 7:95772700-95772722 CACCAACGCTGCCGCCGCCCAGG + Exonic
1029098420 7:98107291-98107313 CCGCAGCCCCGTCCCCGCCGCGG - Intronic
1029720941 7:102364080-102364102 CCCCAGCGCCGCCGGCTCCGGGG - Exonic
1029996754 7:105014154-105014176 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
1030739064 7:113086568-113086590 CACCGCAGCCGCCGCCGCCGCGG - Intronic
1031051885 7:116953446-116953468 TCGCGCCGCCGCCGCCGCCGCGG - Exonic
1032085113 7:128879760-128879782 CAGCAGCACCGCCACCTCCTGGG + Exonic
1032391236 7:131556596-131556618 CAGCCGCGCAGACGCCGCCCAGG - Exonic
1033300013 7:140177026-140177048 CTGAGGCGCCGCCGCCGCCGCGG - Exonic
1034147257 7:148884212-148884234 CGCCGCCGCCGCCGCCGCCGGGG + Exonic
1034469722 7:151248756-151248778 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1034494186 7:151410222-151410244 CACCTCCGCCGCCGCCGCCTGGG + Intronic
1034589736 7:152129069-152129091 CCGCAGCTCCCCCGCCGCCAGGG - Intergenic
1035266104 7:157691014-157691036 GAGCCGCGCCGCCGCCGGCCGGG - Intronic
1035286497 7:157810430-157810452 CAGCAGCCCCGCCGTCCCCGTGG - Intronic
1035286507 7:157810465-157810487 CAGCAGCCCCGCTGTCCCCGTGG - Intronic
1035286592 7:157810709-157810731 CAGCAGTCCCGCCGTCCCCGTGG - Intronic
1035286602 7:157810744-157810766 CAGCAGTCCCGCCGTCCCCGTGG - Intronic
1035286619 7:157810814-157810836 CAGCAGTCCCGCCGTCCCCGTGG - Intronic
1035819033 8:2571862-2571884 CAGCCGCGCCGCCTCCATCGGGG + Intergenic
1036723729 8:11201069-11201091 CCGCAGCGCCGCCGCCGACGGGG - Exonic
1038429852 8:27491318-27491340 GCCCAGCGCCGCCGCCGCAGTGG + Intronic
1038789717 8:30657890-30657912 CAGGCGCGCCGCCGCCTCCCGGG - Intronic
1041059501 8:54022275-54022297 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1041689821 8:60678433-60678455 CAGCAGCGCACCGGCCGGCGGGG + Intergenic
1041689916 8:60678763-60678785 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1045023618 8:98064915-98064937 CACCAGGGCCGCCGCACCCGCGG - Intronic
1045516297 8:102863628-102863650 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
1047203011 8:122782041-122782063 CACCGCCGCCGTCGCCGCCGCGG + Intronic
1049109852 8:140635788-140635810 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1049194520 8:141308115-141308137 CGGCCGCCCCGCCGCCCCCGCGG - Intronic
1049405436 8:142450073-142450095 CAGCAGCGGCCCCGCCGGCGAGG - Exonic
1049759727 8:144326561-144326583 CCGCAGGCCCGCCGCCGCCGTGG + Exonic
1050230921 9:3525589-3525611 CCGCTGCGGCGCCGCCGCCGAGG - Intronic
1050343323 9:4662507-4662529 CAGCAGCCGCGCCACGGCCGTGG + Exonic
1052362212 9:27573442-27573464 CGCCTGCGCCTCCGCCGCCGCGG + Intronic
1052941499 9:34134752-34134774 CAGCAGCGCGGCAGCGGCGGCGG - Intergenic
1053697501 9:40651086-40651108 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1054308790 9:63450486-63450508 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1054447667 9:65385479-65385501 CAGGAGCATCGCGGCCGCCGCGG + Intergenic
1054835655 9:69672554-69672576 CGGTGCCGCCGCCGCCGCCGCGG - Intergenic
1055090996 9:72364835-72364857 AGGTGGCGCCGCCGCCGCCGCGG + Intronic
1055091114 9:72365281-72365303 CGCCGCCGCCGCCGCCGCCGGGG - Intergenic
1055936835 9:81611801-81611823 GATGAGCGCCGCAGCCGCCGCGG - Exonic
1056475282 9:86946762-86946784 CAGCAGCGCGGCCACCATCGCGG + Exonic
1057361146 9:94374747-94374769 GGGCACCGCCGCCGCCTCCGCGG + Exonic
1057489144 9:95508367-95508389 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1057489270 9:95508871-95508893 GCGCAGAGCCGCCGCCGCCGCGG + Intronic
1057662215 9:97013417-97013439 GGGCACCGCCGCCGCCTCCGCGG - Exonic
1058053328 9:100427368-100427390 CAGCGGCGGCGCGGCAGCCGCGG - Intronic
1060209083 9:121699426-121699448 GAGCGCCGCCGCCGCCGCCGCGG + Exonic
1060555279 9:124504741-124504763 CCGCGCCGCCGCCGCCGGCGAGG + Intronic
1061196658 9:129110563-129110585 AGTCCGCGCCGCCGCCGCCGCGG + Exonic
1061391769 9:130320792-130320814 CAGCAGCGCCCCCACCGTCCGGG + Intronic
1061501973 9:131009213-131009235 CAGAAGCGCAGCCGCCGCCATGG - Exonic
1061540737 9:131276919-131276941 CTGCTTCGCCGCGGCCGCCGAGG + Intergenic
1061583907 9:131554576-131554598 CGGCAGCCCCGCCACCCCCGAGG + Intergenic
1062305905 9:135907126-135907148 GAGCGGCCGCGCCGCCGCCGAGG - Exonic
1062341417 9:136095316-136095338 CCGCCGCCCCGCCCCCGCCGCGG - Intergenic
1062346302 9:136116905-136116927 ACCTAGCGCCGCCGCCGCCGGGG - Exonic
1062476012 9:136727948-136727970 CACCAGCGGCGCCTCCTCCGCGG + Intergenic
1062546420 9:137065541-137065563 CAGGAGCGCCAGCGCCGCCTGGG - Exonic
1202779846 9_KI270717v1_random:24374-24396 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1203468898 Un_GL000220v1:107908-107930 CACCACCGCCGCCGCAGTCGCGG - Intergenic
1203469641 Un_GL000220v1:110968-110990 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203469880 Un_GL000220v1:111682-111704 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1203476719 Un_GL000220v1:151880-151902 CACCACCGCCGCCGCAGTCGCGG - Intergenic
1203477462 Un_GL000220v1:154940-154962 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203477701 Un_GL000220v1:155654-155676 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1185457757 X:319237-319259 CGCCGCCGCCGCCGCCGCCGAGG - Intergenic
1185460973 X:332686-332708 CCGCAGCGCCGCCGTCCACGAGG + Intergenic
1189324595 X:40105100-40105122 CAGCAGCGGCGGCGGCGGCGAGG + Intronic
1189391575 X:40581039-40581061 CCGCAGTGCTGCGGCCGCCGCGG + Exonic
1192768007 X:74162325-74162347 CAGCTGCGCCGCCACTGCCGTGG + Intergenic
1192925002 X:75747086-75747108 CGCCACCGCCGCCGCCGCCGCGG + Intergenic
1194977593 X:100409720-100409742 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1200126815 X:153819107-153819129 CAGCCACCCCGCCGCCGTCGCGG - Intronic