ID: 978082897

View in Genome Browser
Species Human (GRCh38)
Location 4:104616368-104616390
Sequence CTCTGCTTAAGGAGAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978082897_978082901 16 Left 978082897 4:104616368-104616390 CCCTCCTCTCTCCTTAAGCAGAG No data
Right 978082901 4:104616407-104616429 GCTGTGAACTGTGCTGCCTGAGG No data
978082897_978082905 23 Left 978082897 4:104616368-104616390 CCCTCCTCTCTCCTTAAGCAGAG No data
Right 978082905 4:104616414-104616436 ACTGTGCTGCCTGAGGTTGGGGG No data
978082897_978082902 20 Left 978082897 4:104616368-104616390 CCCTCCTCTCTCCTTAAGCAGAG No data
Right 978082902 4:104616411-104616433 TGAACTGTGCTGCCTGAGGTTGG No data
978082897_978082908 28 Left 978082897 4:104616368-104616390 CCCTCCTCTCTCCTTAAGCAGAG No data
Right 978082908 4:104616419-104616441 GCTGCCTGAGGTTGGGGGAGGGG No data
978082897_978082904 22 Left 978082897 4:104616368-104616390 CCCTCCTCTCTCCTTAAGCAGAG No data
Right 978082904 4:104616413-104616435 AACTGTGCTGCCTGAGGTTGGGG No data
978082897_978082906 26 Left 978082897 4:104616368-104616390 CCCTCCTCTCTCCTTAAGCAGAG No data
Right 978082906 4:104616417-104616439 GTGCTGCCTGAGGTTGGGGGAGG No data
978082897_978082907 27 Left 978082897 4:104616368-104616390 CCCTCCTCTCTCCTTAAGCAGAG No data
Right 978082907 4:104616418-104616440 TGCTGCCTGAGGTTGGGGGAGGG No data
978082897_978082903 21 Left 978082897 4:104616368-104616390 CCCTCCTCTCTCCTTAAGCAGAG No data
Right 978082903 4:104616412-104616434 GAACTGTGCTGCCTGAGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978082897 Original CRISPR CTCTGCTTAAGGAGAGAGGA GGG (reversed) Intergenic
No off target data available for this crispr