ID: 978086799

View in Genome Browser
Species Human (GRCh38)
Location 4:104664934-104664956
Sequence TGTAGACAGTTATGTACTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978086796_978086799 22 Left 978086796 4:104664889-104664911 CCGGTCACTGAGTAAAATAATTA No data
Right 978086799 4:104664934-104664956 TGTAGACAGTTATGTACTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978086799 Original CRISPR TGTAGACAGTTATGTACTAT GGG Intergenic
No off target data available for this crispr