ID: 978092680

View in Genome Browser
Species Human (GRCh38)
Location 4:104737185-104737207
Sequence CAGAGGTAATAGACGGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978092674_978092680 -10 Left 978092674 4:104737172-104737194 CCCCTACCTATGCCAGAGGTAAT No data
Right 978092680 4:104737185-104737207 CAGAGGTAATAGACGGTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978092680 Original CRISPR CAGAGGTAATAGACGGTAGA TGG Intergenic
No off target data available for this crispr