ID: 978100708

View in Genome Browser
Species Human (GRCh38)
Location 4:104837482-104837504
Sequence GAAAATGCTCAGAAGAAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978100702_978100708 17 Left 978100702 4:104837442-104837464 CCTAGGTAACACTGGAATATCTG No data
Right 978100708 4:104837482-104837504 GAAAATGCTCAGAAGAAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978100708 Original CRISPR GAAAATGCTCAGAAGAAGAT GGG Intergenic
No off target data available for this crispr