ID: 978106131

View in Genome Browser
Species Human (GRCh38)
Location 4:104904105-104904127
Sequence CAGAGCTGCAATTTTTGTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978106130_978106131 2 Left 978106130 4:104904080-104904102 CCAGTGTGAACGGCGGGGGGTGT No data
Right 978106131 4:104904105-104904127 CAGAGCTGCAATTTTTGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978106131 Original CRISPR CAGAGCTGCAATTTTTGTAA AGG Intergenic
No off target data available for this crispr