ID: 978106132

View in Genome Browser
Species Human (GRCh38)
Location 4:104904112-104904134
Sequence GCAATTTTTGTAAAGGACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978106130_978106132 9 Left 978106130 4:104904080-104904102 CCAGTGTGAACGGCGGGGGGTGT No data
Right 978106132 4:104904112-104904134 GCAATTTTTGTAAAGGACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978106132 Original CRISPR GCAATTTTTGTAAAGGACAG TGG Intergenic