ID: 978109467

View in Genome Browser
Species Human (GRCh38)
Location 4:104945206-104945228
Sequence TAGTAAATATACGTGGGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978109458_978109467 29 Left 978109458 4:104945154-104945176 CCCCTCTTCTCTCATTGCCGCTG No data
Right 978109467 4:104945206-104945228 TAGTAAATATACGTGGGTCAAGG No data
978109462_978109467 12 Left 978109462 4:104945171-104945193 CCGCTGGCCTTCTCTTCTAGATC No data
Right 978109467 4:104945206-104945228 TAGTAAATATACGTGGGTCAAGG No data
978109459_978109467 28 Left 978109459 4:104945155-104945177 CCCTCTTCTCTCATTGCCGCTGG No data
Right 978109467 4:104945206-104945228 TAGTAAATATACGTGGGTCAAGG No data
978109464_978109467 -10 Left 978109464 4:104945193-104945215 CCTAAACTTAATGTAGTAAATAT No data
Right 978109467 4:104945206-104945228 TAGTAAATATACGTGGGTCAAGG No data
978109463_978109467 5 Left 978109463 4:104945178-104945200 CCTTCTCTTCTAGATCCTAAACT No data
Right 978109467 4:104945206-104945228 TAGTAAATATACGTGGGTCAAGG No data
978109461_978109467 27 Left 978109461 4:104945156-104945178 CCTCTTCTCTCATTGCCGCTGGC No data
Right 978109467 4:104945206-104945228 TAGTAAATATACGTGGGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978109467 Original CRISPR TAGTAAATATACGTGGGTCA AGG Intergenic
No off target data available for this crispr