ID: 978110433

View in Genome Browser
Species Human (GRCh38)
Location 4:104958003-104958025
Sequence ACTAATACCCAGAATGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978110433_978110437 28 Left 978110433 4:104958003-104958025 CCTTCCACATTCTGGGTATTAGT No data
Right 978110437 4:104958054-104958076 TTTTCTCCCATACAACAGGTTGG No data
978110433_978110436 24 Left 978110433 4:104958003-104958025 CCTTCCACATTCTGGGTATTAGT No data
Right 978110436 4:104958050-104958072 AATATTTTCTCCCATACAACAGG No data
978110433_978110435 0 Left 978110433 4:104958003-104958025 CCTTCCACATTCTGGGTATTAGT No data
Right 978110435 4:104958026-104958048 TGTCTATCACGTGAATAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978110433 Original CRISPR ACTAATACCCAGAATGTGGA AGG (reversed) Intergenic
No off target data available for this crispr