ID: 978111257

View in Genome Browser
Species Human (GRCh38)
Location 4:104966566-104966588
Sequence CCTAGCATGCTGTAAGCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978111252_978111257 15 Left 978111252 4:104966528-104966550 CCAGGGGCTGATAAAACTAGTTA No data
Right 978111257 4:104966566-104966588 CCTAGCATGCTGTAAGCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978111257 Original CRISPR CCTAGCATGCTGTAAGCAAC TGG Intergenic
No off target data available for this crispr