ID: 978113932

View in Genome Browser
Species Human (GRCh38)
Location 4:104996407-104996429
Sequence ACTAGGGTATTGAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978113925_978113932 -5 Left 978113925 4:104996389-104996411 CCATTTTTAACATCCCTCACTAG No data
Right 978113932 4:104996407-104996429 ACTAGGGTATTGAGGGAAGAAGG No data
978113924_978113932 8 Left 978113924 4:104996376-104996398 CCATATACATCAACCATTTTTAA No data
Right 978113932 4:104996407-104996429 ACTAGGGTATTGAGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978113932 Original CRISPR ACTAGGGTATTGAGGGAAGA AGG Intergenic
No off target data available for this crispr