ID: 978114505

View in Genome Browser
Species Human (GRCh38)
Location 4:105003258-105003280
Sequence GTCTCCTGCCTCAGTGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978114500_978114505 17 Left 978114500 4:105003218-105003240 CCTAAAAAGATATCTACAGGAAT No data
Right 978114505 4:105003258-105003280 GTCTCCTGCCTCAGTGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978114505 Original CRISPR GTCTCCTGCCTCAGTGTGGT AGG Intergenic
No off target data available for this crispr