ID: 978119889

View in Genome Browser
Species Human (GRCh38)
Location 4:105065714-105065736
Sequence CTCTGCACAGAGCTTGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978119889_978119895 25 Left 978119889 4:105065714-105065736 CCCAGCTCAAGCTCTGTGCAGAG No data
Right 978119895 4:105065762-105065784 TGTGTTCACTGCACAGAACAGGG No data
978119889_978119896 26 Left 978119889 4:105065714-105065736 CCCAGCTCAAGCTCTGTGCAGAG No data
Right 978119896 4:105065763-105065785 GTGTTCACTGCACAGAACAGGGG No data
978119889_978119894 24 Left 978119889 4:105065714-105065736 CCCAGCTCAAGCTCTGTGCAGAG No data
Right 978119894 4:105065761-105065783 ATGTGTTCACTGCACAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978119889 Original CRISPR CTCTGCACAGAGCTTGAGCT GGG (reversed) Intergenic
No off target data available for this crispr