ID: 978126567

View in Genome Browser
Species Human (GRCh38)
Location 4:105143406-105143428
Sequence TTTTCTATTCTGCAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978126563_978126567 16 Left 978126563 4:105143367-105143389 CCGTTTCAAAAAAAAAAAAAAAG 0: 250
1: 9580
2: 100654
3: 75205
4: 125701
Right 978126567 4:105143406-105143428 TTTTCTATTCTGCAGGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978126567 Original CRISPR TTTTCTATTCTGCAGGTGGG AGG Intergenic
No off target data available for this crispr