ID: 978126980

View in Genome Browser
Species Human (GRCh38)
Location 4:105146656-105146678
Sequence GCCGGCTCTCCTCCTCCGCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 267}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978126980_978126985 -3 Left 978126980 4:105146656-105146678 CCGGGCGGAGGAGGAGAGCCGGC 0: 1
1: 0
2: 2
3: 28
4: 267
Right 978126985 4:105146676-105146698 GGCGGTAGCGGCAGTGGCAGCGG 0: 1
1: 1
2: 30
3: 190
4: 1119
978126980_978126983 -9 Left 978126980 4:105146656-105146678 CCGGGCGGAGGAGGAGAGCCGGC 0: 1
1: 0
2: 2
3: 28
4: 267
Right 978126983 4:105146670-105146692 AGAGCCGGCGGTAGCGGCAGTGG 0: 1
1: 0
2: 1
3: 27
4: 313
978126980_978126986 8 Left 978126980 4:105146656-105146678 CCGGGCGGAGGAGGAGAGCCGGC 0: 1
1: 0
2: 2
3: 28
4: 267
Right 978126986 4:105146687-105146709 CAGTGGCAGCGGCGAGAGCTTGG 0: 1
1: 0
2: 0
3: 26
4: 213
978126980_978126988 12 Left 978126980 4:105146656-105146678 CCGGGCGGAGGAGGAGAGCCGGC 0: 1
1: 0
2: 2
3: 28
4: 267
Right 978126988 4:105146691-105146713 GGCAGCGGCGAGAGCTTGGGCGG 0: 1
1: 0
2: 0
3: 20
4: 246
978126980_978126987 9 Left 978126980 4:105146656-105146678 CCGGGCGGAGGAGGAGAGCCGGC 0: 1
1: 0
2: 2
3: 28
4: 267
Right 978126987 4:105146688-105146710 AGTGGCAGCGGCGAGAGCTTGGG 0: 1
1: 0
2: 0
3: 5
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978126980 Original CRISPR GCCGGCTCTCCTCCTCCGCC CGG (reversed) Exonic
900090132 1:916617-916639 GCCGGCTCTCAGCCGTCGCCTGG - Intergenic
900095961 1:940237-940259 GCCGGCGCCCCTCCCCCGCGCGG - Intronic
901239339 1:7683930-7683952 GCCAGCTGTGCTCCTCAGCCAGG + Intronic
901805614 1:11736592-11736614 GGCGGCTCACCTCCCCCGCGCGG + Intronic
902254398 1:15178231-15178253 GACCGCTCTACTCCTCCACCAGG - Intronic
902429489 1:16352213-16352235 GCCGGCTCCCCTCTGCGGCCCGG + Intronic
902877587 1:19350073-19350095 GGCGCCTCTCCTCCTCCCCATGG + Intronic
902877880 1:19351916-19351938 GCCAGCTTTCCTTCTCAGCCAGG + Intronic
902955378 1:19921584-19921606 GCCAGCTCTGCCCCGCCGCCAGG + Intronic
903285152 1:22272528-22272550 GCCCGTGCTCCTCCTCTGCCTGG - Intergenic
904236954 1:29122505-29122527 GCCGCCTCTCCTCCTCTGCCTGG - Intronic
905297265 1:36962098-36962120 GCCGGTGCTCCTGCCCCGCCTGG - Intronic
906109182 1:43312071-43312093 GCCCCCTCTCCTCCTTCCCCTGG - Exonic
907438781 1:54465644-54465666 CCCGACTCTTCTCCTCTGCCAGG - Intergenic
910646979 1:89524863-89524885 TCCGGCTCGCCGCCTCCGACCGG - Intronic
910826266 1:91410854-91410876 GCCGCCTCTCCTCCACAGGCTGG - Intergenic
910935687 1:92483652-92483674 GCCCGCGCTCTCCCTCCGCCTGG - Intronic
912467887 1:109886511-109886533 GCCGTCACTCCTCTTCTGCCTGG - Intergenic
914910164 1:151778864-151778886 GCTGGCTCTCCAGCTCCACCTGG + Exonic
915034542 1:152910952-152910974 GCTGCCCCTCCTCCTCCTCCAGG - Exonic
915492516 1:156259034-156259056 GCAGGCTCTCCTGCTCAGACTGG + Exonic
915910585 1:159912635-159912657 GCTGGCTCTCCTACTCCCCTGGG + Intergenic
919639675 1:200036060-200036082 GACGCATCTCATCCTCCGCCGGG - Intronic
919747207 1:201016465-201016487 GCCTCCTCTCCTCCTCCCCATGG + Intronic
919757394 1:201074558-201074580 TCAGGCTCTCCGCCTCGGCCAGG + Exonic
919991468 1:202710564-202710586 GCCCGCCCTCCGCCTCCTCCGGG - Intergenic
920939134 1:210464566-210464588 GCCTGCTCTGCTCATGCGCCTGG + Exonic
1063929728 10:11017672-11017694 CCTGGCTCTGCTCCCCCGCCCGG - Intronic
1063995080 10:11611495-11611517 GCCGGATCTGCTCGGCCGCCCGG - Intronic
1064230981 10:13529046-13529068 GCCGGCGCCCCTCCTCCCGCGGG - Intergenic
1065239926 10:23694962-23694984 GCGCGCCCTGCTCCTCCGCCGGG - Intronic
1067564233 10:47325438-47325460 CCCGGCGCTCCTTTTCCGCCTGG - Exonic
1072727178 10:97821912-97821934 TACTGCTCTCCGCCTCCGCCAGG - Intergenic
1072750470 10:97975062-97975084 GCCGGCCCTCCACCGCCACCCGG - Intronic
1075334411 10:121598124-121598146 GCCCGCGCTCCTCCGCAGCCTGG - Exonic
1075629504 10:123992371-123992393 GCCCGCTCCCCTTCGCCGCCAGG - Intergenic
1075662460 10:124207520-124207542 CCCGGCTCCCCTCCTCCCCCAGG - Intergenic
1075722465 10:124595291-124595313 GCAGTCCCTCCTCCTCCCCCTGG - Intronic
1076064676 10:127439888-127439910 GCCGGCTCTCATCCTGGGGCTGG + Intronic
1076891771 10:133288230-133288252 TCCGGAGCTCCTCCTCCGCGAGG + Exonic
1076900589 10:133335717-133335739 GCCGCCTCTGCTTCTCCTCCCGG + Intronic
1077307244 11:1873895-1873917 GCCGGCCTCCCTCCTCTGCCGGG - Intronic
1077307269 11:1873963-1873985 GCCGGCCTCCCTCCTCCGCCGGG - Intronic
1077317690 11:1926714-1926736 GCCGGCGCTCCCCCGCCTCCAGG + Intronic
1077407973 11:2391114-2391136 GATGGCCCTCCTCCTCCTCCTGG - Intronic
1077730365 11:4723341-4723363 GCATGCTCTCAGCCTCCGCCCGG + Intronic
1083305779 11:61761333-61761355 GCCTGCTCTCATCCTGCACCTGG + Intronic
1083485589 11:62981341-62981363 GCTGGCACTCCTCCTCCGGGAGG - Exonic
1083636236 11:64122493-64122515 ACCGGGTCTCCTCCTTCCCCTGG + Intronic
1083667851 11:64285296-64285318 CCCGGCCCTCCTCCCGCGCCCGG - Intronic
1083872819 11:65500675-65500697 GCCTGCTCGCCTCCTCCGTGTGG - Intergenic
1083940726 11:65894094-65894116 GGCGGCGCTCCTCTTCCTCCGGG + Exonic
1084263659 11:67994133-67994155 GCTGTTTCTCCTCCTCAGCCAGG + Intronic
1084429133 11:69101678-69101700 GCAGGAGCTCCTCCTCCTCCTGG + Intergenic
1084809747 11:71604987-71605009 GCTGTTTCTCCTCCTCAGCCGGG - Intergenic
1084891891 11:72240774-72240796 GCCCCCTCTCCTCCTCAGCTCGG + Intronic
1085011013 11:73141925-73141947 TCCGGCCCTCCTCCTCCTCCTGG - Exonic
1088890176 11:114037952-114037974 GGCGGCTCTCCCTCTCCACCTGG + Intergenic
1089776019 11:120836573-120836595 GGGGTCTCTCCACCTCCGCCTGG - Intronic
1091216739 11:133906903-133906925 GCCGGCTCCCGTCATCCCCCAGG + Intergenic
1092217970 12:6695581-6695603 GCTGGCTCTCCTCCTGCCTCAGG + Exonic
1096077775 12:48815653-48815675 GCGGCCTCTCCCCCTCCCCCGGG - Intronic
1096154203 12:49332858-49332880 GCCGGGTCTCCTCCTCTTCCCGG + Exonic
1096491452 12:52015172-52015194 GCTGGCTCTCCTCCTCCTCCAGG - Exonic
1096574477 12:52544238-52544260 GCCAGCTTTCCTCCTCTGCCCGG - Exonic
1096994919 12:55832419-55832441 GCCATCTCACCTCCTCTGCCAGG + Intergenic
1100981560 12:100166495-100166517 GCAGCCTCTCCTCCTACTCCTGG + Intergenic
1101754056 12:107607393-107607415 GCCAGCTCTCCCCCACTGCCGGG + Intronic
1102260881 12:111442639-111442661 GCTGGCTGTCCCCCTCCTCCTGG - Intronic
1103488180 12:121296718-121296740 GCGCGCTCCTCTCCTCCGCCCGG + Intronic
1104857824 12:131910131-131910153 GCAGGGGCTCCACCTCCGCCCGG + Intronic
1104980591 12:132571620-132571642 GCCGGCCCCCCACCTCCTCCTGG - Intronic
1105578917 13:21675595-21675617 GCAGCCTCTCCTCCGCAGCCCGG + Intronic
1105608566 13:21947671-21947693 GACCGCTCTCCTCCACCCCCAGG + Intergenic
1105704352 13:22960258-22960280 CCAGGCTCTCCTTCCCCGCCAGG - Intergenic
1108341591 13:49503129-49503151 GCAGCCTTTCCTCCTCAGCCTGG + Intronic
1112328883 13:98462140-98462162 GCCCACCCTCCTCCTCCTCCCGG + Intronic
1114412965 14:22517910-22517932 CTCGGCTCTCCACCTCCACCAGG + Intergenic
1114620708 14:24094509-24094531 TCCTGCTCTCAGCCTCCGCCAGG + Intronic
1115770640 14:36661947-36661969 GCCCTCTCGCCTCCTCCTCCTGG + Exonic
1116835819 14:49768271-49768293 GACGGCTCTCCGCCGCCGCCGGG - Exonic
1116950147 14:50872064-50872086 GCCCGCCCTCCTCCTCCGCGCGG - Intronic
1117135336 14:52730073-52730095 GCCCGCCCTCCGCCGCCGCCAGG - Intergenic
1117790104 14:59331362-59331384 GGTGGCCCTCCTCCTCCCCCAGG + Exonic
1118704082 14:68463857-68463879 TCCTGCTCTCCTCCTCACCCAGG - Intronic
1119401488 14:74365566-74365588 GCCTGCACTTCTCCTCCTCCTGG - Intergenic
1119715827 14:76858661-76858683 GTCGGCTCACCTCCGCCTCCTGG + Intronic
1121535161 14:94686139-94686161 GCCTGTTCTCATCCTCCGCTGGG + Intergenic
1122081702 14:99271333-99271355 GCCGCACCTCCTCCTCTGCCCGG + Intronic
1122144957 14:99683742-99683764 CCCGGGGCGCCTCCTCCGCCCGG - Intergenic
1122692885 14:103539441-103539463 GCAGGCCGTCCTGCTCCGCCAGG + Intergenic
1122925670 14:104898321-104898343 GCCCTCTCTGCCCCTCCGCCGGG - Intergenic
1122975483 14:105169043-105169065 GCTGCCTCCCCTCCTCCGCCTGG + Intergenic
1123707409 15:22960060-22960082 GCAGGCTCCCCTACTGCGCCTGG + Intronic
1125609586 15:40961296-40961318 CCTGCCTCTCCTCCTTCGCCTGG + Intergenic
1128451167 15:67806708-67806730 TCCGCCTCTCCTCCAGCGCCCGG - Exonic
1128735112 15:70049193-70049215 TCCCTCTCTCCTCCTCAGCCTGG - Exonic
1128842208 15:70859534-70859556 GCATGCTCTCAGCCTCCGCCTGG - Intronic
1129114921 15:73359979-73360001 GCCAGCTCACCTCCTCTTCCTGG - Intronic
1129754447 15:78088634-78088656 TCCTGCTCTCCTTCTCCACCTGG - Intronic
1131048327 15:89330194-89330216 GCCGGCTGACCTCATCCCCCTGG - Exonic
1131513926 15:93065293-93065315 GCCAGCTCTCAACCTCCTCCTGG - Intronic
1131652077 15:94410994-94411016 TCCAGCTCTCTTCCTCCTCCTGG - Intronic
1132111627 15:99105862-99105884 GCCGCGTCTCTTCCTCCGCCTGG - Exonic
1132318013 15:100904422-100904444 GCCCTCTCTCCTGCTCCTCCAGG + Intronic
1132552618 16:559762-559784 GCCGGCTGACCGCCTCCACCTGG - Intergenic
1132640843 16:977649-977671 CCCGGCCCTCCTCCTGCGGCAGG - Intronic
1133232337 16:4372584-4372606 GCCGGGTCTCTGCCTCTGCCAGG + Intronic
1133316193 16:4885513-4885535 CCCGGCTCTTCTCTTCAGCCAGG + Exonic
1137847453 16:51704741-51704763 TCCGTCTCTCCTGCTCCACCAGG + Intergenic
1139402945 16:66696662-66696684 GCCGCCTCTCGCCCGCCGCCCGG + Exonic
1139481013 16:67230719-67230741 GCAGGCTCTCCTCGGCTGCCCGG + Exonic
1139775640 16:69315489-69315511 GGCCTCTCTCCTCCTCCTCCTGG - Intronic
1141121591 16:81362753-81362775 CCCGGCTCTCCTCCCCTTCCTGG + Intronic
1141698904 16:85633526-85633548 GGCCGCACGCCTCCTCCGCCTGG + Intronic
1141941276 16:87277821-87277843 ACCGCCTGTCCTCCTCCTCCAGG + Intronic
1142131705 16:88434272-88434294 GCCACCTCTCCTCCTCTGGCAGG + Exonic
1142552971 17:752258-752280 GCCTGCTCACAACCTCCGCCCGG + Exonic
1143091198 17:4450021-4450043 TCCTTCTCTCCTCCTCCTCCTGG + Intronic
1143513774 17:7409169-7409191 GCAGGCTCTCCCTCTCCCCCTGG + Intronic
1143517343 17:7426543-7426565 GCAGGTTGTCCTCCTCCTCCAGG - Exonic
1145034775 17:19533549-19533571 CCCGGCTCTCCACCTCCGCTGGG - Intronic
1145248467 17:21284800-21284822 GCCGCCGCTGCTCCTCCGCCTGG + Exonic
1146058711 17:29593570-29593592 GCCGTCCCTCCTCCCCGGCCGGG + Exonic
1146079125 17:29761354-29761376 GCGGGCCCGCCTCCGCCGCCGGG - Intronic
1146272188 17:31491715-31491737 GTCCCCTCTCCTCCTCCTCCTGG - Intronic
1146594482 17:34157109-34157131 CCCTCCTCTCCTCCTCCTCCAGG + Intronic
1146646320 17:34579533-34579555 GCCCGCCCTCCTCCTCCGTCCGG - Intergenic
1147865742 17:43550982-43551004 GACTGCTCTCCTCCTCCACAGGG - Intronic
1148861704 17:50607952-50607974 GCCGGGCCTCCTCTTCCTCCTGG - Exonic
1148899550 17:50865982-50866004 GCAGCCCCTCCTCCGCCGCCTGG + Intronic
1148955132 17:51347412-51347434 GCCTGCTGTCCTCTTCGGCCAGG - Intergenic
1151642436 17:75405768-75405790 GCAAGCGCTCCTCCTCAGCCGGG + Intergenic
1151745368 17:76009001-76009023 GCCGGCCCACCTCCTCATCCAGG + Exonic
1151745623 17:76010252-76010274 GCTTGCCCTCCTCCTCCACCTGG + Exonic
1152079316 17:78176698-78176720 GCCGGCACACCACCTGCGCCAGG + Intronic
1152657359 17:81526196-81526218 GCCTGGGCTCCTCCTCAGCCTGG + Intergenic
1154219401 18:12438913-12438935 GCAGGCTCTTCTCCTCCACTTGG - Intergenic
1154954786 18:21242791-21242813 GCCCCCTCGCCGCCTCCGCCGGG - Intronic
1155003013 18:21704690-21704712 GCCGGCTCTCCTCCCGCCGCAGG - Exonic
1155096216 18:22559206-22559228 ACCAGCCCTCCTCCACCGCCGGG - Intergenic
1158947214 18:62457461-62457483 GCTGGCTTTTCTCCTCCTCCGGG + Intergenic
1160668580 19:344884-344906 GCCCGCTCTCCGCCCCCTCCAGG - Intergenic
1160737574 19:671003-671025 GCCTGAACTCCTCCTCCGCAGGG - Intergenic
1160869999 19:1273346-1273368 GCCCGCTCCCGTCCCCCGCCTGG - Intronic
1161153450 19:2721071-2721093 GCCGCCTCCCCTCCCCCACCCGG - Intronic
1161383262 19:3977610-3977632 GGTGGCTCTCCCCCTCCCCCAGG - Exonic
1161435097 19:4258367-4258389 TCCGCCGCTCCTCCTCCGACAGG - Exonic
1161620014 19:5292884-5292906 GCAGGGTCCCCTCCCCCGCCTGG - Intronic
1162033031 19:7925557-7925579 GGCGGGTCCCCTCCTCCGCAGGG - Exonic
1162967508 19:14162987-14163009 GCCCGTTCTCGTCCACCGCCAGG + Exonic
1163641603 19:18465454-18465476 TCCGCGTCTCCTCCTCCGCCTGG + Exonic
1164156437 19:22600319-22600341 GCAGCCTCTCCTCCTGCTCCCGG - Intergenic
1164706703 19:30325293-30325315 GCCAGTTCTCCCCCTCAGCCTGG + Intronic
1165157084 19:33795576-33795598 GCCGGCACTGCGCCCCCGCCTGG - Intergenic
1166391631 19:42411762-42411784 GCCGGCCCTGCTCCCCTGCCTGG + Intronic
1167085904 19:47309678-47309700 GCCGGCCCCCCTTCTCTGCCTGG + Intronic
1167134745 19:47609697-47609719 GCAGGCTCTCCGCCTCCGGCCGG - Intronic
1167239196 19:48333395-48333417 GCCAGTTCTCCACCTCCGACCGG + Exonic
1167466041 19:49651580-49651602 GCCTGGGCTCCTCCTCCGGCTGG - Exonic
1168237441 19:55072104-55072126 GCAGCCTGTCCTCCTCCTCCAGG + Intronic
1168350945 19:55675246-55675268 GGCGGCTCCCCTCCCCCGCCCGG + Intronic
925984794 2:9206930-9206952 GCCGCCCCTGCTCCGCCGCCAGG + Exonic
926054765 2:9768134-9768156 GCCGGCTCTCCTGTTCCACGAGG - Intergenic
928025357 2:27735286-27735308 GCCAAGTCTCCTCCTCTGCCTGG - Intergenic
932866034 2:75344105-75344127 GGCAGCTCTCCTCCACCACCTGG + Intergenic
933628719 2:84632352-84632374 CCCCACTCTCCTCCTCAGCCAGG + Intronic
934976401 2:98805802-98805824 GCCGGCTCTCCTGCTTTCCCAGG + Intronic
935607538 2:104985627-104985649 GCCTTCTCTCCTCCTTCCCCTGG - Intergenic
936010545 2:108922559-108922581 GCAGGCTCTCCTTCTTCTCCTGG + Intronic
937132595 2:119524453-119524475 GCCGGCGCGCCTCCTCCACCCGG + Exonic
943820350 2:192314335-192314357 GCCGGCTCTTCTCCACAGCCAGG + Intergenic
944158266 2:196632262-196632284 GCTGTCTCTCCTGCTCTGCCAGG - Intergenic
946128578 2:217586400-217586422 GCCGGCTGTGCTCCCCGGCCTGG + Intronic
946322809 2:218963299-218963321 GCCAGCTCTCCCCCTCCCTCCGG - Intergenic
948225455 2:236306179-236306201 GCCAGCGCTCCTCCTCCTCACGG + Intergenic
948508315 2:238446210-238446232 GCCTGCTCTCCTCATCCATCAGG + Intronic
948694895 2:239728287-239728309 TCCAGCTCTCCTCCTCCTCGCGG + Intergenic
1169262524 20:4149008-4149030 CCCGGCTCTCAGCCTCCCCCGGG + Intronic
1170204682 20:13785278-13785300 GCGGGCTCACCTCCTCCTTCAGG - Exonic
1172398001 20:34623271-34623293 CCAGGATCTCCTCCTCCTCCTGG - Intronic
1172519997 20:35560186-35560208 GCCGGAACTCCGCCTCCTCCAGG + Intergenic
1173192073 20:40884410-40884432 GCAGGCTCATCTCCTCCCCCAGG + Intergenic
1174806695 20:53609794-53609816 GCAGGCTCCCCTCCCCCTCCGGG + Intronic
1179626850 21:42653804-42653826 GCCGGATCCCATCCTGCGCCCGG - Exonic
1179630750 21:42677010-42677032 GCGGGCTCTGCTCCTCCCCAAGG - Intronic
1180180474 21:46116630-46116652 GCCGGCTTTCCTCCTACACAGGG + Exonic
1181489681 22:23253842-23253864 GCCGGCGCTGCTCCTCTGCCCGG - Exonic
1183073557 22:35412538-35412560 GACGGAACTCCTCCTCCTCCTGG - Exonic
1183360017 22:37378627-37378649 GCCCTCTCTCCTCTTCCTCCTGG + Intronic
1183573448 22:38671539-38671561 GCCGGCTCTACCCCTCTTCCTGG - Intronic
1184826094 22:46952296-46952318 GCCGCTTGTCCTCCTCTGCCTGG + Intronic
1185196467 22:49473552-49473574 GCTGGTTCTGCTCCTCCCCCAGG + Intronic
1185349407 22:50326802-50326824 GCCCGCTCACCTCCAGCGCCTGG + Exonic
954401280 3:50321158-50321180 GCGCGCTCGCCTCCCCCGCCCGG + Exonic
954582857 3:51712451-51712473 GCCTTCTCTACTCCTCCCCCAGG + Exonic
956179029 3:66500694-66500716 GCCTGCGCTCTTCGTCCGCCCGG + Exonic
959754052 3:109875393-109875415 AGCAGCTCTCCTCCTCCCCCAGG - Intergenic
961453968 3:127015299-127015321 GCCGGCCCTGCTCCTTCTCCTGG + Exonic
961585044 3:127915412-127915434 GCCCTCCCTCCTCCTCCGCAGGG + Exonic
962222439 3:133574418-133574440 GCAGGCTCTCCACCTCGGGCTGG + Intronic
964790458 3:160449774-160449796 GGCGGCTCTCAGCATCCGCCTGG - Exonic
967628454 3:191713820-191713842 GCAGGCTCTTCTCTTCCACCTGG + Intergenic
967648160 3:191952328-191952350 TCCGGGTCTCCTCCCCAGCCAGG + Intergenic
967824873 3:193869907-193869929 GCCGGCCCTCCTCGTCTTCCTGG - Intergenic
967930592 3:194687660-194687682 CACGGTTCTCCTCCTCCTCCGGG - Exonic
968093927 3:195914856-195914878 TCCGTCTCTTCACCTCCGCCAGG - Intergenic
968473557 4:792492-792514 CCTTGCGCTCCTCCTCCGCCTGG + Exonic
968589325 4:1449781-1449803 GGCTCCTCTCCTCCTCCTCCGGG - Intergenic
968729132 4:2261574-2261596 GCCTGCGCGCCTCCTCCTCCAGG + Intronic
969370158 4:6726930-6726952 TCCTTCTCTCCTCCTCCCCCAGG - Intergenic
969379388 4:6783608-6783630 TGCGGCCCTCCTCCCCCGCCCGG - Intronic
969791285 4:9495459-9495481 GCTGTTTCTCCTCCTCAGCCGGG - Intergenic
971763725 4:30802905-30802927 GTTTGCTCTCCTCCTCCTCCTGG - Intronic
975890058 4:79016959-79016981 CCAGGCTCTCCTCCTGCTCCAGG - Intergenic
976235374 4:82891157-82891179 GCCGCCCCTCCTCCCCGGCCAGG + Exonic
976899761 4:90158582-90158604 GCGGGCTCCCCTCCCCAGCCTGG + Intronic
978126980 4:105146656-105146678 GCCGGCTCTCCTCCTCCGCCCGG - Exonic
980063381 4:128155691-128155713 GGCGGCGCTCCTCTTCCTCCGGG - Intronic
980174162 4:129324785-129324807 GCTTACTCTCCTCCTCCTCCCGG + Intergenic
980930348 4:139177694-139177716 GCCGGCTTTCCCCCGCCGGCCGG + Intergenic
982261069 4:153494882-153494904 GCCGGGGCTCCTGCTCTGCCGGG + Intronic
985772745 5:1823475-1823497 GCCTGGACTCCACCTCCGCCAGG - Intergenic
990007742 5:50963559-50963581 GCCTCCGCTCCTCCTCCGCCCGG + Intergenic
990410255 5:55534746-55534768 GGCTGCTCTCCTCCTCCGGCTGG - Exonic
992563068 5:77971916-77971938 GCCTGCTCTCCTCCACTCCCCGG + Intergenic
996404916 5:123095176-123095198 CCCGGCCCTCCTCCTCTACCCGG - Intronic
997304023 5:132825545-132825567 GCCGGCTCCCCCTCCCCGCCCGG + Exonic
997635154 5:135399188-135399210 CCGCGCTCTCCCCCTCCGCCCGG + Exonic
998308301 5:141101298-141101320 GGCGGCTCTCCCCCTCGGTCTGG + Exonic
1000086263 5:157889968-157889990 GCCAGCCCTCTTCCTCCACCAGG - Intergenic
1000210092 5:159100497-159100519 GCCGGCTCCCCTGCGCCACCGGG - Intergenic
1000858595 5:166430298-166430320 GCTGTCTCTCATCCTCCACCTGG + Intergenic
1001530199 5:172455893-172455915 GACGGCTCTCAGCCTCGGCCAGG + Intergenic
1002449370 5:179310216-179310238 GACGGCCCTCCTCCCCCACCAGG + Intronic
1002567644 5:180120682-180120704 GTCGGCTCTCGTCCTCCTCTAGG + Intronic
1002711870 5:181200000-181200022 GCCGACCCTCCTGCTCCACCAGG + Exonic
1002877724 6:1226336-1226358 GCCGCCTCTGCTCCTCTGGCAGG - Intergenic
1003188145 6:3850282-3850304 GCCGGTTCTCCTCCTCCTCGCGG - Exonic
1004228915 6:13813985-13814007 GCCCCCTCTCCTCTCCCGCCCGG + Intronic
1004395699 6:15245256-15245278 GCCGGCCCTCCTCCGCCCCCCGG - Intergenic
1004910394 6:20277426-20277448 CCCGCCTCTCCTCCTCAGTCAGG + Intergenic
1004924499 6:20403773-20403795 GCCGGCCCCCCACCTCCCCCCGG + Intronic
1006119532 6:31795623-31795645 GCCCGCTCGACTCCTCCGCCCGG - Exonic
1006338165 6:33431728-33431750 GCAGGCTTTCCTCTTCCCCCTGG - Intronic
1006845672 6:37059789-37059811 CCTGTCTCTCCTCCTCCTCCAGG - Intergenic
1010786256 6:80004537-80004559 GCCGCCCCTCCTCCTGCGTCAGG - Intronic
1011311248 6:85981864-85981886 ACCTGCTCTCCTCCTGCCCCAGG + Intergenic
1012912821 6:105136922-105136944 GCCGGCTTTCCCCCCGCGCCGGG - Intronic
1013060511 6:106629466-106629488 GCCCGCTCTCCTTAGCCGCCGGG + Exonic
1016328275 6:142927191-142927213 GGCTGCCCTCCTCCACCGCCTGG + Intronic
1018471421 6:164101331-164101353 GCAGGGTCCCCTCCTCCACCTGG + Intergenic
1018756438 6:166853507-166853529 GCTGGCTCTCCTCCTCCATCAGG + Intronic
1019100494 6:169625741-169625763 GCCGGCACCCCTACTCCGTCTGG + Intronic
1019421743 7:954122-954144 GCCGCCTCCCCTCCCCCGCCGGG - Intronic
1019527651 7:1487911-1487933 TCCGGGTCTCCTCATCCGTCAGG + Exonic
1019597344 7:1864254-1864276 GCCGCCTCCCCTCCTCCTTCAGG - Intronic
1020309600 7:6858082-6858104 GCTGTTTCTCCTCCTCAGCCGGG + Intergenic
1021162992 7:17298917-17298939 GCCCAGGCTCCTCCTCCGCCCGG + Exonic
1024005803 7:45224380-45224402 GCCGGCTCTCCATCGCCCCCAGG + Intergenic
1025926197 7:65962288-65962310 GCCAGCTGTGCTCCTCCACCAGG - Intronic
1026107535 7:67433045-67433067 CTCGGCTCTCCTCCTCTGTCTGG + Intergenic
1026833266 7:73622916-73622938 GCCGGCACTCCTCCTCCTAAGGG - Intronic
1027001423 7:74657380-74657402 CCCGGCTCCCCTCCCCCACCCGG + Intergenic
1027774213 7:82444070-82444092 GCCGGCTCGCTCCCGCCGCCCGG + Intergenic
1028078068 7:86539115-86539137 CCCTCCTCTCCTCCTCCCCCAGG - Intergenic
1030345689 7:108430549-108430571 GCCTGCTCTTCTCCCCAGCCTGG - Intronic
1033842387 7:145390108-145390130 TCCAGCTCTACTCCTCCCCCAGG - Intergenic
1034556451 7:151853221-151853243 GCAGCCCCTCCTCCTCCTCCAGG - Intronic
1035688878 8:1547064-1547086 GCCGCCTCTCCTCCCAGGCCTGG - Intronic
1036130945 8:6109441-6109463 GCAGTCTCTCCTCCTCCTCCAGG - Intergenic
1038204928 8:25457810-25457832 GCCGGCGCGCCTCCTCCCGCAGG + Intronic
1038489473 8:27959510-27959532 GCTGGCTCTCCTCCTAGTCCGGG - Intronic
1038963466 8:32547956-32547978 GCCCGCTCCCCTCCGCAGCCAGG - Intronic
1039463143 8:37762652-37762674 GCCAGCTCTCCACATCCCCCGGG - Exonic
1042695169 8:71547664-71547686 GCGGGCTCTCGGCCGCCGCCTGG + Intronic
1045023504 8:98064481-98064503 GCCAGCTCCCTTCCTCCTCCAGG + Exonic
1047259195 8:123241074-123241096 GCCGTCCCTCCTCCTCCACGGGG - Intronic
1047304761 8:123643685-123643707 GCCAGCCCTGCTCCTCAGCCTGG - Intergenic
1049684184 8:143932689-143932711 GCCAGCTCTCCCCCGCCACCCGG - Exonic
1049777527 8:144413549-144413571 CCGGGCTCTCCTCCGCCACCTGG + Exonic
1049989731 9:979246-979268 GCCCTCACTCCTCCTCCTCCTGG - Intronic
1053011704 9:34637420-34637442 GCCGCCCCTCTGCCTCCGCCAGG - Exonic
1056532582 9:87499314-87499336 GCTGCCTCTCCTCCACCCCCAGG - Intronic
1057141278 9:92728113-92728135 CCTGGCTCTCCTCCTCCTGCTGG + Intronic
1060520823 9:124292979-124293001 GCAGGCTCTGCTCCTCCTGCCGG - Exonic
1061063103 9:128260629-128260651 GCAGCCTCTCCTCCTGCTCCCGG + Exonic
1061181541 9:129027799-129027821 GCCTCCTCCCCTCCTCAGCCAGG + Intronic
1062022448 9:134326011-134326033 CCCGGCTCTCCGCCTCCTCCGGG + Intronic
1062422333 9:136488809-136488831 GGCGGCTCTCTGCCTCCCCCTGG - Intergenic
1062569923 9:137180327-137180349 GCCGCTTCTCATCCTCCTCCCGG + Exonic
1186486371 X:9937203-9937225 GGCGGCTCTCCTTCTCTGGCTGG - Exonic
1190304323 X:49073579-49073601 GCAGGCCCTCCTCATCAGCCAGG + Intronic
1190440187 X:50469383-50469405 GCATGCTCTCCCCCTCCTCCCGG + Intronic
1193600099 X:83501146-83501168 GCAGCCTCTGCTGCTCCGCCAGG - Intergenic
1195416120 X:104621365-104621387 GCCAGCTCTCCTCCTACCCCAGG - Intronic
1200042419 X:153379770-153379792 CTGGGCTCTCCTCCTCCCCCAGG - Intergenic
1200902877 Y:8450713-8450735 CCTGTCTCTCCTCCTCTGCCTGG + Intergenic