ID: 978130411

View in Genome Browser
Species Human (GRCh38)
Location 4:105189280-105189302
Sequence TGGCATTTACCAAGAACCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 173}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978130411 Original CRISPR TGGCATTTACCAAGAACCCC GGG Intronic
904264278 1:29309301-29309323 TGCCTTTTAACAAGATCCCCCGG + Intronic
904939690 1:34157049-34157071 TGGCACAAACCAGGAACCCCAGG - Intronic
907712892 1:56900772-56900794 TGGCATGTGCCAAGCCCCCCAGG - Intronic
912759939 1:112357846-112357868 TGCCATTTGCCAAGAGCCTCAGG - Intergenic
913286240 1:117229400-117229422 TAGCATGTACCAAGCACCTCAGG + Intergenic
915020622 1:152775624-152775646 TGGCATCTAACAAGATCCACAGG - Intronic
915431663 1:155871611-155871633 TGGCTCTTGCCAAGAGCCCCTGG - Intronic
916171565 1:162004906-162004928 TGCCATCTACCATCAACCCCTGG + Intronic
920413271 1:205779366-205779388 GGGTATTTAACAAGTACCCCAGG - Intergenic
922527723 1:226318557-226318579 TGCCATTAAAAAAGAACCCCAGG - Intergenic
924543272 1:245001327-245001349 TGGCATTTATAAAGAGCACCAGG - Intronic
1069091373 10:64203253-64203275 TGCACTTTACCAAGATCCCCAGG - Intergenic
1069532540 10:69229837-69229859 CGGGATTTACCAAGAACACCTGG - Intronic
1072047344 10:91670207-91670229 CTGCATTTAACAAGATCCCCAGG - Intergenic
1073038241 10:100579399-100579421 TGGCATTCACAATGACCCCCGGG + Intergenic
1073300440 10:102468000-102468022 TTGCATTTCCCAAGACCACCCGG - Intronic
1073849877 10:107602523-107602545 TGGAAGTTACCTAGAAGCCCTGG + Intergenic
1075387291 10:122064574-122064596 TTGCAGTTTCCAAGAACCACTGG + Intronic
1078239194 11:9514787-9514809 TGGCCTTTACCAACTTCCCCAGG - Intronic
1079085974 11:17445178-17445200 TGACATTTATCAAGAACACCAGG - Intronic
1079638237 11:22772499-22772521 TGGCATTTTCTAAAAACCCTAGG + Intronic
1081802470 11:45869573-45869595 CGGCAGCTACCAACAACCCCAGG + Exonic
1083337801 11:61935928-61935950 TGGCATATACCTAAAACTCCAGG - Intergenic
1083418920 11:62542763-62542785 GGGCCTTTACCCAGAACCACTGG + Intronic
1083447819 11:62721487-62721509 TGACATTTACCAATAACTCTTGG - Intronic
1085502811 11:77038680-77038702 TGGCTTTTATGAAGACCCCCAGG - Intronic
1085839531 11:79995439-79995461 GGGTATGTTCCAAGAACCCCAGG + Intergenic
1086543595 11:87942207-87942229 TGGAATTTAACAAGATCCCTGGG - Intergenic
1087050454 11:93881686-93881708 TGCAATTCACCAAGAACCACAGG + Intergenic
1087261092 11:96013549-96013571 TTGCATTTCCCAAGACCACCTGG + Intronic
1087862868 11:103184375-103184397 TGGCACTTACCAGGGACCCCAGG + Intronic
1089632955 11:119794731-119794753 TGACTTTGACCGAGAACCCCTGG - Intergenic
1092060400 12:5546114-5546136 TTGCATATACCCAGGACCCCAGG + Intronic
1093259586 12:16918497-16918519 TTGCATTTATTTAGAACCCCAGG + Intergenic
1098137092 12:67414206-67414228 CTGCATTTACCATGATCCCCAGG - Intergenic
1102046330 12:109832502-109832524 TGCCACTTCCCAAGCACCCCGGG + Intronic
1104082359 12:125441487-125441509 TTGCATTTAGAAAGAAACCCTGG - Intronic
1105239421 13:18597007-18597029 TAGCATTTAACAGGAATCCCTGG + Intergenic
1105307235 13:19177454-19177476 TGCCATTTACCCAGCCCCCCAGG - Exonic
1105784611 13:23736081-23736103 TTGTATTTTCCAAGCACCCCTGG + Intronic
1109075690 13:57832181-57832203 TTGCATTTTCCAAGACCACCTGG + Intergenic
1112428258 13:99325014-99325036 TGTAATTTGCCAAGAACACCAGG + Intronic
1112859059 13:103808122-103808144 TGGCATGTGCCCATAACCCCAGG - Intergenic
1117467193 14:56005503-56005525 TTGCATTTCCAAGGAACCCCAGG + Intergenic
1118039773 14:61904116-61904138 TGTCATTAACCAATAACCTCTGG + Intergenic
1118469064 14:66057638-66057660 TGGCCTTTACCAAGTGCTCCTGG - Intergenic
1118929295 14:70225407-70225429 TTGCATTTCCCAAGACCACCTGG + Intergenic
1120746477 14:88156994-88157016 TGCATTTTACCAAGATCCCCAGG - Intergenic
1126113733 15:45190065-45190087 TGTAACTTACCAAGATCCCCAGG - Intronic
1126982082 15:54255670-54255692 TTGCATTTCCCAAGAAACCCTGG - Intronic
1127523120 15:59762807-59762829 CTGCATTTAACAAGATCCCCTGG + Intergenic
1128148146 15:65344205-65344227 TGGCATTTACAAATAGCCTCAGG + Intronic
1132039231 15:98511380-98511402 TGGGCTTTAACAAGATCCCCAGG - Intronic
1132261693 15:100430981-100431003 TGTAGTTTACCAAGAACCCTAGG - Intronic
1133545297 16:6800429-6800451 TTGCATTTAGCAAGATCCCCAGG - Intronic
1133844238 16:9439301-9439323 TCTCCATTACCAAGAACCCCAGG + Intergenic
1134156774 16:11850769-11850791 TAGCATTTACTGAGAACTCCTGG + Intronic
1135279095 16:21138447-21138469 GGGTGTTTACCAAGGACCCCAGG + Intronic
1137684316 16:50375133-50375155 GGGCATTTTCCAGGAGCCCCAGG + Intergenic
1142863271 17:2776383-2776405 TTGCATCTTCCAGGAACCCCTGG + Intergenic
1143807122 17:9438446-9438468 TGTCTTTTAACAAGATCCCCAGG + Intronic
1143946009 17:10592697-10592719 CTGCATTTAACAAGATCCCCAGG + Intergenic
1148590798 17:48815390-48815412 TGACATTTTCCAAGAACCACTGG - Intronic
1148835926 17:50465739-50465761 TCGCCCTTACCAATAACCCCTGG - Exonic
1151401027 17:73856286-73856308 TGCCTTTTAACAAGATCCCCTGG - Intergenic
1152495301 17:80667047-80667069 TGGATTTTCCCAATAACCCCGGG + Intronic
1155235854 18:23817845-23817867 AGGCATTTACAAAGCTCCCCTGG - Intronic
1155346673 18:24864151-24864173 CTGCATTTAACAAGATCCCCAGG - Intergenic
1156988139 18:43373726-43373748 TTGCATTTAACAAGATCCCTAGG + Intergenic
1157245639 18:46051980-46052002 TGGCATTCCCTGAGAACCCCTGG + Intronic
1158234927 18:55302142-55302164 TGGCACTTGCCAAGGACCCTCGG + Intronic
1158323923 18:56293963-56293985 TGGAATTTAACAGGATCCCCAGG - Intergenic
1158705469 18:59788660-59788682 TGGCATTTTCCCAGATGCCCGGG + Intergenic
1160916079 19:1497345-1497367 TGGCATTTAAGGAGACCCCCAGG - Exonic
1160920945 19:1520306-1520328 TGGCCTTTACCAAGCACCCGTGG - Intergenic
1167264346 19:48476120-48476142 TTACATTTACCAGGAAACCCTGG - Intronic
1168692978 19:58387927-58387949 TGTCTTTCACCTAGAACCCCTGG - Exonic
926259894 2:11249670-11249692 TGGCCTTTGCCAATAGCCCCTGG - Exonic
926341718 2:11909593-11909615 TGGCATATAGCAAGCACCCAGGG + Intergenic
926825444 2:16901507-16901529 TTGCATTTTCCAAGACCACCCGG + Intergenic
927873376 2:26638509-26638531 TGGCATATAGGAGGAACCCCAGG + Intronic
928902432 2:36334297-36334319 AGTCATTTACCAAGAACTCTTGG - Intergenic
931789046 2:65647078-65647100 CTGCATTTAACAAGAACTCCAGG + Intergenic
932000346 2:67879070-67879092 TGCCTTTTAACAAGATCCCCAGG - Intergenic
935426847 2:102928373-102928395 GGACATTTAACAAGCACCCCAGG - Intergenic
937160611 2:119758143-119758165 TGCCATTTAATAAGAACTCCAGG + Intergenic
937642679 2:124231082-124231104 TGGCTTCTACCCAGAACTCCTGG + Intronic
937745725 2:125411511-125411533 TGGCAATTCCCAAGAACTTCTGG + Intergenic
938298617 2:130194313-130194335 TGCCATTTACCCAGCCCCCCAGG - Exonic
938407546 2:131040807-131040829 TGGCATTTACCAAGGTTCACTGG + Intronic
938458114 2:131480200-131480222 TGCCATTTACCCAGCCCCCCAGG + Exonic
938762432 2:134437880-134437902 TGGCATGTACCTGTAACCCCAGG + Intronic
940034160 2:149295828-149295850 TGCCATTTAACAAGCTCCCCAGG - Intergenic
944278844 2:197871414-197871436 TGCATTTTACCAAGAACCTCAGG - Intronic
944353620 2:198759091-198759113 TGCATTTTAGCAAGAACCCCAGG - Intergenic
945564967 2:211386601-211386623 TGGATTTTAACAAGATCCCCAGG - Intronic
946488772 2:220127287-220127309 TGTCAGTTACCAAGAAAGCCTGG - Intergenic
1170930026 20:20761366-20761388 TTTCATTTACAAAGAACCTCAGG - Intergenic
1171779434 20:29405811-29405833 TGGCATTTATGAAGCTCCCCAGG + Intergenic
1172167417 20:32907664-32907686 TGGAATTTTCCCAGAAGCCCTGG + Intronic
1172979711 20:38931691-38931713 TACCATTTACCAAGTAACCCTGG - Intronic
1173022342 20:39277377-39277399 TGGCAGTCAGCAAGAAACCCTGG + Intergenic
1173902947 20:46604400-46604422 TGGCCTTCACCAAAGACCCCAGG - Intronic
1181040562 22:20190540-20190562 TGGCATTTCCCAAGACTACCCGG + Intergenic
1181728924 22:24830748-24830770 AGGCATTTACCAAGCCCTCCCGG - Intronic
1181915301 22:26274990-26275012 TGGCATTGCCCAAGGACCCCAGG + Intronic
1182056344 22:27358302-27358324 TGCTTTTTACCAAGATCCCCTGG + Intergenic
1183324046 22:37181880-37181902 CTGCATTTAACACGAACCCCGGG + Exonic
1184935637 22:47718386-47718408 TGACATTTTCCAAGAGTCCCTGG - Intergenic
949575956 3:5339411-5339433 TTGCCTTTACCAAGTTCCCCAGG - Intergenic
951993434 3:28701261-28701283 TGGCATTTTCCATGAATCCTTGG - Intergenic
952684048 3:36129737-36129759 TGGCATTACCCAAGAGCTCCTGG + Intergenic
954999075 3:54910045-54910067 TTGCACTTACCAAGAACTCCTGG + Intronic
955770588 3:62381105-62381127 AGTCATTCACCTAGAACCCCAGG - Intergenic
957479307 3:80770804-80770826 TTGCATTTTCCAAGACCACCTGG - Intergenic
957560290 3:81812919-81812941 TGACATTCACCAAGAAGTCCAGG - Intergenic
962133777 3:132710759-132710781 AGGCATTAAAGAAGAACCCCTGG + Intronic
964094269 3:152913232-152913254 TGGGTTTTATCAAGATCCCCAGG + Intergenic
964223596 3:154371964-154371986 CGGCATCTACCAAGGACCCCTGG + Intronic
964662727 3:159138430-159138452 TGGTATTAACCATGAACTCCTGG - Intronic
967353457 3:188541220-188541242 TGGCATTTAACAAGCCCTCCAGG - Intronic
968018942 3:195366571-195366593 CTGCATTTACCAAGATCTCCAGG + Intronic
969525730 4:7703160-7703182 TGGCCTCTGCCAACAACCCCCGG + Intronic
969553991 4:7893700-7893722 CTGCCTTTAACAAGAACCCCCGG - Intronic
973080803 4:45990441-45990463 AGGAATTTACCAAGACCGCCAGG - Intergenic
977756895 4:100682512-100682534 TTGCATTTCCCAAGACCACCTGG + Intronic
978130411 4:105189280-105189302 TGGCATTTACCAAGAACCCCGGG + Intronic
980758749 4:137200348-137200370 CTGCATTTAACAAGATCCCCAGG + Intergenic
981822421 4:148901384-148901406 TGCATTTTAACAAGAACCCCTGG + Intergenic
988432731 5:31138450-31138472 TGGCATATATCAAGAAGTCCTGG + Intergenic
994571252 5:101516817-101516839 TGGCATGGGCCAAGACCCCCTGG + Intergenic
995531119 5:113092789-113092811 TTGCTTTGACCAAGTACCCCAGG - Intronic
997073174 5:130641643-130641665 TGACTTCTACCAAGGACCCCTGG + Intergenic
998042657 5:138962552-138962574 TGGCATTTGCCAGGAACTCTGGG - Intronic
999939353 5:156524050-156524072 TGGCAGTTTCCAAGAACCTATGG + Intronic
1000288628 5:159849212-159849234 TGCATTTTACCAAGATCCCCAGG - Intergenic
1000758812 5:165195314-165195336 TGGCATTTGCCAGAAACCCATGG - Intergenic
1000837257 5:166170790-166170812 TGCCTTTTAACAAGATCCCCAGG + Intergenic
1001309428 5:170600273-170600295 TGGCATTGGCCAAAAACTCCAGG - Intronic
1002719940 5:181252679-181252701 TGCCATTGACCATCAACCCCTGG - Intergenic
1003852754 6:10241890-10241912 TCACATTTAACAAGCACCCCAGG + Intergenic
1006854189 6:37121479-37121501 CTGCATTTAGCAAGATCCCCAGG + Intergenic
1008139151 6:47811866-47811888 TGGAATTTCCCAGCAACCCCTGG - Intronic
1008727715 6:54441994-54442016 TTGCATTTCCCAAGACCACCTGG - Intergenic
1009452446 6:63817639-63817661 TGGCATTCACCAGGAAGCCCTGG + Intronic
1009874508 6:69488906-69488928 TAGCACATACAAAGAACCCCAGG - Intergenic
1011334810 6:86248666-86248688 GTGCATTTAACAAGATCCCCTGG - Intergenic
1011504410 6:88025908-88025930 TGCCTTTTAACAAGATCCCCAGG + Intergenic
1015001671 6:128224289-128224311 TGTCACTTACCAAGTAACCCTGG + Intronic
1017874271 6:158511909-158511931 TAGCAGTTACCAAGAGACCCAGG - Intergenic
1018997550 6:168721657-168721679 TGGCATTTACCGGGGACCCTGGG - Intergenic
1021984051 7:26081914-26081936 TGGCCCTGACCAAGAGCCCCAGG - Intergenic
1023981352 7:45072497-45072519 TTGCATTTGCCAGGATCCCCAGG + Intronic
1024097477 7:45994627-45994649 TGACATTTTCAAAGAACCACAGG - Intergenic
1027982173 7:85239140-85239162 CTGCATTTAGCAAGATCCCCAGG - Intergenic
1029357880 7:100066241-100066263 TGGCATTGACTAATAACCCTTGG - Intronic
1032429909 7:131852288-131852310 TGGCACACACCCAGAACCCCAGG + Intergenic
1032565160 7:132934160-132934182 TGCAATTTAACAAGATCCCCAGG - Intronic
1033295008 7:140124546-140124568 TGGCTTTTAACTAGAACCTCTGG - Intronic
1033538872 7:142337910-142337932 TGGCATTTACTAAGCATCACTGG + Intergenic
1035812525 8:2504542-2504564 TGTCATTTACCAAACACACCAGG + Intergenic
1035960187 8:4127957-4127979 TGGCATTTACCAATATCACAAGG - Intronic
1036611264 8:10351782-10351804 TGCATTTTACCAAGATCCCCAGG - Intronic
1039772266 8:40699162-40699184 TGGCATATACCAGGATCACCAGG + Intronic
1041969515 8:63721940-63721962 TGGCTTTTGCCAAGGACACCTGG - Intergenic
1042846193 8:73171739-73171761 AGGCATGTACCAAGATGCCCAGG - Intergenic
1044589294 8:93898364-93898386 GGACATTTTCCAAGAACTCCAGG - Intronic
1046286296 8:112096589-112096611 TGACATTTACCAATACCCCTGGG - Intergenic
1047776294 8:128073479-128073501 CTGCATTTACCAAGTACCCCTGG - Intergenic
1048185044 8:132232257-132232279 TGCCATTTAACAAGACCCCTTGG - Intronic
1050451602 9:5787361-5787383 TGGTATTTAGCAAGAACCTTGGG - Intronic
1051763410 9:20495339-20495361 TTGCATTTAACAAGATGCCCAGG + Intronic
1053231831 9:36416645-36416667 CAGCCTTTCCCAAGAACCCCTGG + Intronic
1057264078 9:93602697-93602719 TGGCATTTCCCATGCACCCGAGG - Intronic
1058974731 9:110115254-110115276 TGGCCTTTACCCAGAACCAGGGG - Intronic
1061742174 9:132715316-132715338 TGGCATGTGCCTATAACCCCAGG + Intergenic
1186126322 X:6418380-6418402 TTGCATTTTACAAGCACCCCAGG + Intergenic
1186209453 X:7234174-7234196 TTGCATTTTCCAGGATCCCCTGG - Intronic
1186257011 X:7732885-7732907 TGCATTTTACCAAGACCCCCAGG + Intergenic
1187701556 X:21968418-21968440 TGGCCAGGACCAAGAACCCCTGG + Intronic
1187880133 X:23839130-23839152 TGCCTTTTACCAAGCTCCCCGGG + Intronic
1189546287 X:42045779-42045801 TGGCATCTAGCAAGAAACCAAGG - Intergenic
1193681047 X:84519050-84519072 TGGCCTTTTCCAAGTACCTCTGG + Intergenic
1196018432 X:110964345-110964367 TTGAATTTAGCAAGAACTCCTGG - Intronic
1197969371 X:132098964-132098986 CGGCATTTAACAAGAAACTCAGG + Intronic
1198186350 X:134257411-134257433 TGGCCTTTCTCCAGAACCCCAGG + Intergenic