ID: 978133371

View in Genome Browser
Species Human (GRCh38)
Location 4:105226858-105226880
Sequence AACCTTTTGAAAGGTATGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 230}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978133371_978133374 29 Left 978133371 4:105226858-105226880 CCTAACATACCTTTCAAAAGGTT 0: 1
1: 0
2: 2
3: 31
4: 230
Right 978133374 4:105226910-105226932 GATCTCTTTGTCCAGAATTCTGG 0: 1
1: 0
2: 0
3: 16
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978133371 Original CRISPR AACCTTTTGAAAGGTATGTT AGG (reversed) Intronic
906192869 1:43909506-43909528 AACTTTTTGAAAGCTATATTTGG - Intronic
908327687 1:63039704-63039726 AACCTTTCTGAAGGTAAGTTTGG + Intergenic
909647107 1:77930017-77930039 AACCTTGTGACAGTTAAGTTAGG - Intronic
909813299 1:79959010-79959032 GACCTTTGGGAAGGTATGATTGG - Intergenic
909939769 1:81597743-81597765 AACCTTTTGATGGGTTTATTGGG - Intronic
909960971 1:81842171-81842193 AACTTTTTCAAAAGTATTTTTGG + Intronic
910513193 1:88028864-88028886 AACCTCTTGTAAGGCAAGTTTGG + Intergenic
910704602 1:90114875-90114897 AGCCTTTAGAAAGGAATTTTAGG + Intergenic
911303226 1:96201756-96201778 AACCTTTTGAAATTTTGGTTGGG - Intergenic
911790861 1:102014037-102014059 AAGCATTTGAAAGGTGAGTTGGG + Intergenic
912388915 1:109288148-109288170 AACCAATTGAAAGGAATGTCTGG - Intergenic
912862959 1:113231203-113231225 AATTTTTTGAAAAGCATGTTAGG - Intergenic
916792922 1:168139680-168139702 GACATTTTGAAAGGCATTTTGGG + Intergenic
916826417 1:168446037-168446059 AAGCTTTGGAAAGGAAAGTTCGG - Intergenic
917316801 1:173734267-173734289 CACCTCTTGAAAGTTATGTTGGG - Exonic
918327224 1:183421428-183421450 CAACGTTTGAAAAGTATGTTTGG + Intergenic
918770152 1:188546357-188546379 AATCTTTTAAAATGTATGTACGG + Intergenic
918948957 1:191109777-191109799 AACCTCTTGTAAGGCAGGTTTGG + Intergenic
919252684 1:195078515-195078537 AAACTGATGCAAGGTATGTTTGG - Intergenic
919384925 1:196909418-196909440 AAACTTTTGAAAAATATGTTTGG + Intronic
921577731 1:216856597-216856619 AACCTTTGGAAAGTTATCTCTGG + Intronic
922539162 1:226406003-226406025 AAACATTTGAAAGGTAATTTGGG + Intronic
923147029 1:231205420-231205442 AATCTTTAGAAAAGTATCTTTGG + Intronic
923810775 1:237312569-237312591 AATATTTTGAAATGAATGTTTGG + Intronic
1064921252 10:20521441-20521463 AATCTTTTGAATGGTACGTGTGG - Intergenic
1066323853 10:34333865-34333887 AAGGTTTTGAATGATATGTTAGG + Intronic
1066351367 10:34640314-34640336 CACCTTTTAAAAGGCATTTTTGG + Intronic
1068198598 10:53751181-53751203 AAGATTTGGAAAGGTATATTTGG + Intergenic
1072556527 10:96519314-96519336 AACCTAGTGAATGGTATGCTTGG - Exonic
1072832722 10:98676065-98676087 AACCCTTTGAAGGGTAGATTGGG + Intronic
1078228119 11:9412101-9412123 AACCTTTTAAAATGTATGCTAGG + Intronic
1078610857 11:12818260-12818282 AACCTTGAGAAAGGGATTTTGGG - Intronic
1078992399 11:16663094-16663116 AATCTTATAAAAGGTATGTATGG + Intronic
1079785699 11:24668914-24668936 AACATTTTCAAACCTATGTTTGG - Intronic
1083529460 11:63406181-63406203 AGACTTTTCAAAGGTATCTTTGG - Intronic
1085732146 11:79009297-79009319 AACCTTTGGTTAGGTATGTGGGG + Intronic
1085964538 11:81505474-81505496 TACATTTTAAAAGGTATATTTGG - Intergenic
1086433096 11:86754808-86754830 AGCTTTTAAAAAGGTATGTTGGG - Intergenic
1087166445 11:95009082-95009104 AACCTTACCAAAGGTAAGTTAGG - Intergenic
1087576573 11:99997203-99997225 AACTTTTTGAAGGGTTTTTTTGG + Intronic
1087621180 11:100544338-100544360 TACTTTTTGAAAGGTAGGTATGG + Intergenic
1089379685 11:118019163-118019185 AACTTTATGAAAATTATGTTAGG + Intergenic
1090109685 11:123893147-123893169 AACCTTTTTAAAAGTATGTGTGG + Intergenic
1090555105 11:127865853-127865875 CATCTTTAGAAAGGTATGTTAGG + Intergenic
1091069066 11:132546245-132546267 CACTTTTTAAAAGGGATGTTGGG - Intronic
1091074109 11:132598854-132598876 AACCTTTTAAAAAATATATTTGG + Intronic
1092072442 12:5642636-5642658 ATCCTTTTGAAATGTATGTCAGG + Intronic
1093355992 12:18167963-18167985 AACCTTTTAAATGATATGTTTGG + Intronic
1095350600 12:41206257-41206279 AACCATTTGAAAAATCTGTTTGG - Intronic
1097441158 12:59610368-59610390 AACCTTATAAATTGTATGTTGGG + Intronic
1098691670 12:73497420-73497442 AACTTTTTGAAAAATATGATTGG + Intergenic
1098871314 12:75820386-75820408 AACCTTTAGAGATTTATGTTGGG + Intergenic
1100916826 12:99433449-99433471 AACCTTTTCAAAGGTCTGTGAGG - Intronic
1101247495 12:102898646-102898668 AACCTTTTCAAAGGATTGTTGGG - Intronic
1101484248 12:105136247-105136269 ATGTTGTTGAAAGGTATGTTTGG + Intronic
1103654255 12:122457669-122457691 AACCTTCTGAAAAGGAAGTTTGG + Intergenic
1104683776 12:130771163-130771185 AACCTCTAGAGAGGTAGGTTTGG - Intergenic
1106291969 13:28371959-28371981 AACCTTGTGACAGGCATATTAGG - Intronic
1107583959 13:41823718-41823740 AACCCTTCTAAGGGTATGTTAGG + Intronic
1108327632 13:49349034-49349056 AATCTGTTGAAAGGTATATTAGG - Intronic
1108777564 13:53784882-53784904 AACCTTTTGGCAGGTGTATTAGG + Intergenic
1108901591 13:55415770-55415792 AACATTTTGCAAAATATGTTTGG - Intergenic
1109419933 13:62098959-62098981 TGCCTCTTCAAAGGTATGTTAGG - Intergenic
1109711565 13:66167285-66167307 AACCTTTTGAAAAAAATCTTAGG + Intergenic
1110080982 13:71311295-71311317 AAACATTTGGAAGGTATTTTGGG + Intergenic
1111405358 13:87796973-87796995 AACCTTTTTAATGGTAGATTGGG + Intergenic
1112161203 13:96869910-96869932 GACCATTTGAAAGTTATCTTTGG + Intergenic
1112838126 13:103541964-103541986 AAACATTTGAAAAGTATGTTGGG - Intergenic
1114325733 14:21586981-21587003 AACCATTTCAAAGGTATTTAGGG - Intergenic
1117025493 14:51615933-51615955 CATCTTTAGAAAGGTATCTTTGG - Intronic
1117647426 14:57866213-57866235 CACCTGATGAAAGGGATGTTTGG + Intronic
1118372409 14:65148816-65148838 AACCTAGTGATAGGTATGTGTGG - Intergenic
1118372985 14:65153501-65153523 AATCTTTTAAAAGTTATCTTTGG - Intergenic
1121999953 14:98639183-98639205 AAAATTTTCAATGGTATGTTTGG + Intergenic
1124025590 15:25962435-25962457 AACTTTTTGAAAGGCATTTTTGG + Intergenic
1124406054 15:29392619-29392641 AACTTTTTGCCTGGTATGTTAGG + Intronic
1125399009 15:39280526-39280548 AACTTTTTTAAACGTAAGTTAGG - Intergenic
1125972063 15:43919925-43919947 AAGCTTATGAAAGATAAGTTTGG + Intronic
1126381526 15:48052650-48052672 AACCTAATGAAAGGTATGTTAGG + Intergenic
1126423686 15:48502806-48502828 ATCCTTTTGAAAAGTAGGTGAGG + Intronic
1127675095 15:61230534-61230556 ATCCTTTTGAAAGGAAGGTGGGG - Intergenic
1127752726 15:62061462-62061484 AACTTTTTGAAATATATTTTAGG - Intergenic
1130402398 15:83569579-83569601 ACCCTTCTGAAGGGTAGGTTGGG - Intronic
1131988925 15:98073491-98073513 AACCTTTTGTATGGAATTTTGGG + Intergenic
1133161673 16:3915969-3915991 ATGCTTTGGAAATGTATGTTGGG + Intergenic
1133628547 16:7595289-7595311 GACATTTAGAAAGGTATTTTTGG + Intronic
1135132021 16:19861015-19861037 GGCCTTTTGAATGGTATGCTAGG - Intronic
1137783607 16:51118673-51118695 AACCATTTGAAAGAAATCTTAGG + Intergenic
1146823574 17:36004001-36004023 AAGTTTTTGAAAGGTAGTTTGGG + Intergenic
1148436451 17:47689642-47689664 AACCTTTTAAAAATTCTGTTTGG + Intergenic
1150306335 17:64088439-64088461 TACCTTTTGAAAGGTATTTAAGG + Intronic
1153116852 18:1668077-1668099 AATCTTTTAAAAGGCATATTTGG + Intergenic
1153117054 18:1671175-1671197 AATCTTTTAAAAGGCATATTTGG + Intergenic
1155337472 18:24779449-24779471 AAACTCTTGAAAGGTGTGTAAGG + Intergenic
1156587361 18:38446095-38446117 AACTTTTTCAAAGGTATGGAGGG - Intergenic
1156929716 18:42627043-42627065 AACTTTATCAAAGGTATGTATGG - Intergenic
1157796398 18:50579458-50579480 AACCACTTGAGAGGTATGTGTGG + Intronic
1158027596 18:52920042-52920064 ATCTTTGTGAAAGGTATGTCTGG - Intronic
1158046556 18:53162442-53162464 AACCTTTTAAAAGATAAGTTAGG + Intronic
1158630369 18:59108894-59108916 AACATTTTGAAAAGTATACTTGG + Intergenic
1158975319 18:62706026-62706048 AACCTTTTTAAAAGCATGTTGGG - Intergenic
1159487341 18:69080015-69080037 AACTTTTTAAAAGATATTTTTGG + Intergenic
1159750062 18:72289280-72289302 ACCCTTTTGTAAAGTATTTTGGG + Intergenic
1160468777 18:79107460-79107482 GACCTTTTGAGTGGGATGTTGGG + Intronic
1162853948 19:13453961-13453983 GACATTGTGAAATGTATGTTTGG + Intronic
1165269273 19:34691023-34691045 AACTTTTTGCAAGTTTTGTTAGG + Intergenic
1165972693 19:39645890-39645912 TACCTTTTGAAAGGTCTGTAGGG + Intergenic
925681731 2:6429401-6429423 CACATTTTGGAAGGTATGTTTGG - Intergenic
927440822 2:23115956-23115978 ATCCTTTAGAAAGGAATGTTTGG - Intergenic
929295930 2:40246636-40246658 TTCCTTATGAAAGGTCTGTTTGG - Intronic
931874494 2:66497138-66497160 AACCTCTAGAAAGGTATCTGAGG - Intronic
933310703 2:80658255-80658277 AACCTTGAGAAAATTATGTTAGG + Intergenic
933320278 2:80766220-80766242 AACGTTTTGAAAGATTTTTTTGG - Intergenic
936655015 2:114474825-114474847 AAACTTTTGAAAGTCATGGTAGG + Intronic
936814162 2:116439442-116439464 ACCCTTTTATAAGGTATGTTGGG + Intergenic
937595968 2:123673856-123673878 AGCCTTTTGAGATGTGTGTTAGG - Intergenic
938226144 2:129618225-129618247 ACCCTTTTGAAAGGGAAGGTTGG + Intergenic
938844259 2:135192485-135192507 AAGATTTTGATAGGTGTGTTAGG - Intronic
939851089 2:147305799-147305821 AAACATTTTAAAGGTAAGTTTGG + Intergenic
940196697 2:151103233-151103255 AAACTTTTGAGAGGGATGGTGGG - Intergenic
940673771 2:156703932-156703954 AACGTTTTGAAAGCAATGTTTGG - Intergenic
941196687 2:162460969-162460991 AAGATTTTAAAAGGTATGTGTGG + Intronic
941354896 2:164478511-164478533 ACCCTTTTGAAAAATATCTTAGG + Intergenic
941380147 2:164782905-164782927 AACCATTTAAAATGTATCTTGGG - Intronic
942632024 2:177960771-177960793 AAACTATTGAAAGTTATCTTGGG + Intronic
943026214 2:182632175-182632197 AATCTGATGAAATGTATGTTTGG - Intergenic
943091289 2:183377901-183377923 AACTTTTTCAAAGGTATTGTGGG - Intergenic
943113924 2:183642454-183642476 AACCTTTAGAAAGGTAAATTAGG - Intergenic
943304814 2:186247492-186247514 AACATTTTGAAAACTATGCTGGG + Intergenic
943371126 2:187017273-187017295 AACCTTTTGAAGTGTATTATTGG + Intergenic
1169152670 20:3302518-3302540 AACCCTTTAAAAAGTATTTTAGG - Intronic
1170829502 20:19827850-19827872 TACCTTTTTAAAGGTACTTTTGG - Intergenic
1176668865 21:9713223-9713245 AACCTTTGGAAAGTGATTTTTGG - Intergenic
1177211168 21:18072821-18072843 AACTTTTTTATAGGTATATTTGG - Intronic
1177755165 21:25337686-25337708 AACCTTTTTACAGTTATATTGGG + Intergenic
1181679730 22:24485548-24485570 AACTTTTTTAAAAGTATGTTTGG - Intergenic
1181899815 22:26144336-26144358 CCACTTTTGAAAGGTTTGTTTGG + Intergenic
951660100 3:25053894-25053916 CATCTTTTGAAATGTATCTTTGG + Intergenic
954695473 3:52422574-52422596 AACCCCTTGAAAGGTAGATTAGG - Intronic
956038161 3:65117986-65118008 AAAATTTTAAAGGGTATGTTTGG - Intergenic
956156050 3:66298250-66298272 AACCATTTGATAGGTATATCAGG + Intronic
957029087 3:75219528-75219550 ATCCTATTGAAAGTAATGTTTGG + Intergenic
957931889 3:86889906-86889928 ATACTTTTGAAAGGAATGTAAGG - Intergenic
957977026 3:87459902-87459924 AATGTTTTGAAATATATGTTAGG - Intergenic
960171661 3:114469108-114469130 AATTTTTTAAAATGTATGTTTGG - Intronic
962156328 3:132952508-132952530 AACCTTCTGAAAGGCATGCTTGG + Intergenic
963447402 3:145430590-145430612 AACCTCTTCAAAGAAATGTTTGG - Intergenic
964693635 3:159482158-159482180 TTCCTTGAGAAAGGTATGTTGGG + Intronic
965007787 3:163047422-163047444 GACCTTTTGAAAATGATGTTAGG + Intergenic
965310485 3:167121354-167121376 AATCTTTTGAAAGGGATTGTAGG - Intergenic
966963153 3:184961363-184961385 AACATTTTTAAAAGTATGTGTGG - Intronic
967093307 3:186153800-186153822 AACCATTTGAAAGGTGTCTGAGG + Intronic
969098263 4:4750505-4750527 CACCTTTTGAAAGGGCTGCTTGG + Intergenic
970650639 4:18174084-18174106 AGCCCTTTGAAAGGGCTGTTTGG + Intergenic
971833599 4:31732487-31732509 ATCATTTTGAATGATATGTTTGG + Intergenic
971850779 4:31984043-31984065 AACCTTGTGAAGGTTTTGTTTGG - Intergenic
974667588 4:64985171-64985193 AAGATTTTCAAAGGTAGGTTTGG - Intergenic
975928238 4:79486253-79486275 AGCTTTTTGAGAGGTATGATGGG + Intergenic
977164640 4:93679953-93679975 AATTTTTTGAAAGGTTTTTTTGG - Intronic
977356203 4:95950515-95950537 AACCTTATGAAAGGTAACTATGG + Intergenic
978133371 4:105226858-105226880 AACCTTTTGAAAGGTATGTTAGG - Intronic
978767921 4:112423408-112423430 AACCTAGAGAAAGGAATGTTTGG + Intronic
979137835 4:117131618-117131640 ATGCTTGTGAAAGTTATGTTTGG + Intergenic
979413295 4:120405695-120405717 AACATTTTGAAAAGTATCTCTGG - Intergenic
980283253 4:130750053-130750075 AACATATTGAAAGAAATGTTAGG + Intergenic
981028436 4:140099757-140099779 AAGGTTTTGAGAGGTGTGTTGGG - Intronic
981108769 4:140911534-140911556 AACCTTTGGAAAGGAAATTTTGG - Intronic
982541587 4:156678940-156678962 AGGCTTTTGAATGGTATGATTGG - Intergenic
983513614 4:168634553-168634575 AACCTTTTCAAAGCTTTGCTGGG + Intronic
983921701 4:173352720-173352742 AACCTGCTGAAAATTATGTTAGG - Intergenic
984468019 4:180126162-180126184 AACCATTTGAAATCCATGTTTGG + Intergenic
985405917 4:189638290-189638312 AACCTTTGGAAAGTGATTTTTGG + Intergenic
985803341 5:2020592-2020614 AACCTATTGAAAGTAATTTTGGG - Intergenic
987388761 5:17355375-17355397 AATCTTTTGAAATATATATTTGG - Intergenic
988017328 5:25575789-25575811 AATCAATTGAAAGGAATGTTTGG - Intergenic
988040643 5:25885203-25885225 AACTTTTTGAAAGTTATACTTGG + Intergenic
988892986 5:35639387-35639409 AACCTTTGTAATGGTATATTTGG + Intronic
990305766 5:54492875-54492897 AACCTTTTCCAAGGTAATTTGGG - Intergenic
990745276 5:58952755-58952777 TACATTTTGAAAGGTAATTTGGG + Intergenic
990858467 5:60299129-60299151 AACCTTCTGATAGGAATTTTAGG + Intronic
991635901 5:68704878-68704900 AACTTTTTGAAGGGTTTTTTTGG + Intergenic
993284236 5:85969604-85969626 AATCTTTTGTATGGTATTTTGGG + Intergenic
994077095 5:95665671-95665693 AGCCTTTTAAAAGGTATTTCTGG + Intronic
994196307 5:96926619-96926641 AACCTTTTAAAAATTATGTTAGG - Intronic
994609174 5:102014456-102014478 AATCTTCTGGAAGGCATGTTGGG - Intergenic
994966721 5:106681805-106681827 AATCTCTAGAAAGGTAGGTTAGG - Intergenic
995295046 5:110510605-110510627 CACCTTTTGATAGGGTTGTTTGG - Intronic
995555633 5:113325263-113325285 AACCCTTTGAAAGATATTATAGG + Intronic
996704286 5:126481406-126481428 AATCATTTGAATGGTATGGTTGG - Intronic
996780525 5:127181791-127181813 AACCCTGTGAAAGGTTTGCTGGG - Intergenic
999445688 5:151637121-151637143 ATCCTAATGAAAGTTATGTTGGG + Intergenic
1001282614 5:170397953-170397975 AATCTATAGAAAGGGATGTTGGG + Intronic
1002588643 5:180271060-180271082 AAACTTTTAAAAAGTATGTGAGG + Intronic
1003120556 6:3315947-3315969 ATCCTTTTTCAAAGTATGTTAGG + Intronic
1004340582 6:14804430-14804452 AACCTTTTGAACTGTTTTTTTGG + Intergenic
1004559165 6:16730765-16730787 TAGCTTTTGAAAGATATGTGTGG - Intronic
1004920874 6:20374422-20374444 AACATTTGGGAAGGTATCTTGGG - Intergenic
1006250881 6:32782876-32782898 AAGCTCTTGTAAGGTAGGTTTGG - Intergenic
1008003204 6:46382403-46382425 AACCCTTAGAAAGCTATGCTGGG + Intronic
1008760950 6:54850457-54850479 AACCTTTTGAAATGAAAATTTGG - Intronic
1008972438 6:57385318-57385340 AATTTTTTAAAAAGTATGTTTGG - Intronic
1009161347 6:60286845-60286867 AATTTTTTAAAAAGTATGTTTGG - Intergenic
1009894637 6:69733335-69733357 AACCTTTTCCAAGGTAAGTTAGG + Intronic
1010796941 6:80127730-80127752 GACATTTTCAAAGGTATGATTGG + Intronic
1010816543 6:80364795-80364817 AACCTGTTGAAAGCAAAGTTGGG + Intergenic
1011604214 6:89086576-89086598 AAGTTTTTAAAAGGTATATTGGG + Intergenic
1011957415 6:93040036-93040058 AACATTTTTAAGGGTATGGTTGG - Intergenic
1012611141 6:101222460-101222482 CATTTTTTTAAAGGTATGTTGGG + Intergenic
1012788084 6:103657782-103657804 AACTGTTGGAAAGGCATGTTTGG - Intergenic
1013892905 6:115046548-115046570 AACCTTTAGAAAGGTAAGCCTGG + Intergenic
1015675415 6:135741406-135741428 ATTCTTTTGAAAGCTATGCTAGG + Intergenic
1017290262 6:152727631-152727653 TGGCTTTTGTAAGGTATGTTGGG + Intergenic
1021113044 7:16717292-16717314 AGCCTTCTAAATGGTATGTTTGG + Intergenic
1021152718 7:17171039-17171061 AAATTTTTAAAAAGTATGTTTGG + Intergenic
1021871939 7:25015619-25015641 AATCCTCTGAAAGGGATGTTGGG - Intergenic
1027455334 7:78384212-78384234 TACATTATGAAAGCTATGTTAGG - Intronic
1027862748 7:83605775-83605797 CACCTTTTGATAGGGTTGTTTGG + Intronic
1028209494 7:88055759-88055781 AGCGTTATGAAAGGTGTGTTAGG - Intronic
1028347093 7:89796806-89796828 GACCTCTTGAAAGGTACGTGTGG + Intergenic
1032534488 7:132650682-132650704 AACCATCTGACAGGAATGTTGGG - Intronic
1034077460 7:148245960-148245982 AAGCTTTTTAATGCTATGTTTGG - Intronic
1034587690 7:152110080-152110102 AACATTATGAAATGTCTGTTGGG + Intronic
1035964503 8:4175562-4175584 GATTTTTTGAAAGGTATATTAGG + Intronic
1038100864 8:24373095-24373117 AACCATTTGAAAAGTATTTTTGG + Intergenic
1039361228 8:36879389-36879411 AACCTTGAGAAATGTATGTCTGG + Intronic
1041436787 8:57850618-57850640 TGCCTTTGGAAAGATATGTTTGG - Intergenic
1042154999 8:65835013-65835035 AACCTTTTGAAAAGCATGTTTGG + Intronic
1042159993 8:65883008-65883030 AACTATTATAAAGGTATGTTAGG + Intergenic
1043163904 8:76879591-76879613 ATCCTTGAGAAAGGAATGTTTGG - Intergenic
1043237277 8:77884061-77884083 AATCTTTTGAAAGGTAAAGTGGG + Intergenic
1043752300 8:83953100-83953122 AACATTTTGACAGGTTTGTTAGG + Intergenic
1043952816 8:86328135-86328157 AACTTTTTAAAAGATTTGTTTGG - Intergenic
1044328373 8:90887400-90887422 AAGCTTTTTAAAACTATGTTTGG - Intronic
1044547094 8:93472037-93472059 AACCATTTGAAAGGGATGCCAGG + Intergenic
1045980118 8:108175217-108175239 AAGATTTAGAAAGGTATATTTGG - Intergenic
1046299451 8:112267792-112267814 AAGCTTTAGAAGGGTTTGTTTGG + Intronic
1046541979 8:115597140-115597162 AACCTTTTCATAGGTTTGCTAGG - Intronic
1046853697 8:119005186-119005208 AACCTTTTGAAAGAGAAATTGGG + Intronic
1046988612 8:120422108-120422130 AAACTTTTAAATGGTATGTCAGG + Intronic
1047267480 8:123320286-123320308 AACCTTAAGAAATGTATTTTTGG + Exonic
1047796534 8:128262051-128262073 AACAATTTGAAAGATATATTTGG + Intergenic
1048442134 8:134467959-134467981 TACGTTTTGAAAGGAATGCTTGG - Intergenic
1050978456 9:11973844-11973866 AAACTTTTTAAGGGTATTTTTGG + Intergenic
1053728817 9:41031557-41031579 AACTTTTTGAAATATCTGTTGGG + Intergenic
1053826687 9:42032164-42032186 TCCCTTTGGAAAGGTATGTAAGG - Intronic
1054603872 9:67155259-67155281 TCCCTTTGGAAAGGTATGTAAGG + Intergenic
1054699693 9:68400526-68400548 AACTTTTTGAAATATCTGTTGGG - Intronic
1055205946 9:73730550-73730572 AATGTTTTGAAAAGTATGATAGG + Intergenic
1055683718 9:78745959-78745981 AACATTTTGAAATCTATGTTAGG + Intergenic
1061913291 9:133736283-133736305 AACATTTTGAAAGTTAGGTGCGG - Intronic
1203657001 Un_KI270753v1:7712-7734 AACCTTTGGAAAGTGATTTTTGG + Intergenic
1187514294 X:19952670-19952692 AAGCTTATGGAAAGTATGTTAGG - Intronic
1189093514 X:38113202-38113224 AGCCTTCTGAAAGGCATGTCAGG + Intronic
1192696665 X:73423244-73423266 AATCTTTTGTAAGGTAGGTCTGG - Intergenic
1193749430 X:85324864-85324886 GACTTCTTGTAAGGTATGTTTGG + Intronic
1193836012 X:86344812-86344834 AAAGTTGTGAAATGTATGTTTGG - Intronic
1195240167 X:102943653-102943675 GTCTTTTTGAAATGTATGTTTGG + Intergenic
1195241507 X:102957518-102957540 GACCTTTTGTAAGGTAGGTCGGG + Intergenic
1195381185 X:104272560-104272582 AGCCCTTTGAAAGGTTTGTCTGG + Intergenic
1196435941 X:115674749-115674771 AACCTTTCCTAAGGTATATTGGG - Intergenic
1196540063 X:116897467-116897489 TCCCTTTTAAAAGATATGTTTGG - Intergenic
1199518048 X:148700964-148700986 AACTTTTTGGTAGGTATGATGGG + Intronic
1201506501 Y:14707045-14707067 AACATTTTGAGAGGTATCTTAGG + Intronic
1201628468 Y:16041662-16041684 TTCCTTTTGAAAGGAATGTTTGG - Intergenic