ID: 978137087

View in Genome Browser
Species Human (GRCh38)
Location 4:105275539-105275561
Sequence ACACTTTACCAGCCAAGGTT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 85}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978137079_978137087 17 Left 978137079 4:105275499-105275521 CCAAGACCCTCTGTCTAAGCTCA 0: 1
1: 0
2: 1
3: 10
4: 149
Right 978137087 4:105275539-105275561 ACACTTTACCAGCCAAGGTTTGG 0: 1
1: 0
2: 1
3: 15
4: 85
978137080_978137087 11 Left 978137080 4:105275505-105275527 CCCTCTGTCTAAGCTCAGTCTAC 0: 1
1: 0
2: 1
3: 9
4: 142
Right 978137087 4:105275539-105275561 ACACTTTACCAGCCAAGGTTTGG 0: 1
1: 0
2: 1
3: 15
4: 85
978137078_978137087 22 Left 978137078 4:105275494-105275516 CCAAGCCAAGACCCTCTGTCTAA 0: 1
1: 0
2: 5
3: 29
4: 237
Right 978137087 4:105275539-105275561 ACACTTTACCAGCCAAGGTTTGG 0: 1
1: 0
2: 1
3: 15
4: 85
978137081_978137087 10 Left 978137081 4:105275506-105275528 CCTCTGTCTAAGCTCAGTCTACC 0: 1
1: 0
2: 1
3: 12
4: 118
Right 978137087 4:105275539-105275561 ACACTTTACCAGCCAAGGTTTGG 0: 1
1: 0
2: 1
3: 15
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978137087 Original CRISPR ACACTTTACCAGCCAAGGTT TGG Exonic
902652875 1:17848107-17848129 ACACTGAACCAGCCAAGACTTGG - Intergenic
902836042 1:19047414-19047436 ACAAATTACCAGCCAGGCTTGGG + Intergenic
904272815 1:29361775-29361797 ACACTCTGCCACCCCAGGTTTGG - Intergenic
908459355 1:64334242-64334264 GCAGCTTAGCAGCCAAGGTTTGG - Intergenic
909427474 1:75543786-75543808 ACAATTTAGCAAACAAGGTTGGG - Intronic
917048673 1:170892905-170892927 ATACTTTACCAGGCCAGGTGCGG + Intergenic
1068191576 10:53659428-53659450 TCACCTTACCAGCTAAGCTTAGG - Intergenic
1070843582 10:79504775-79504797 GCATTTTGCCTGCCAAGGTTGGG + Intergenic
1070930085 10:80254825-80254847 GCATTTTGCCTGCCAAGGTTGGG - Intergenic
1070965263 10:80526502-80526524 AGAGTTTACCAGCCAAGGGCTGG - Exonic
1073081304 10:100862679-100862701 ACACTGTGCCAGCCAAGATCAGG - Intergenic
1075435022 10:122432263-122432285 ACACTTTAACAGTAAATGTTGGG - Exonic
1076406523 10:130215657-130215679 ACACCTTGCCAGGCCAGGTTAGG - Intergenic
1082735927 11:56855502-56855524 ACACACTGCCAGACAAGGTTAGG + Intergenic
1084304074 11:68270416-68270438 ACATATAACAAGCCAAGGTTCGG - Intronic
1090248289 11:125233408-125233430 ACCCATTGCCAGCCAAGGGTTGG + Intronic
1093619682 12:21274226-21274248 ACACTTTGAAAGCCAAGGTTAGG + Intronic
1094189409 12:27682242-27682264 ACACTTTACTAGCCCAAGTTGGG + Intronic
1095040212 12:37432889-37432911 ACACTTGAACAGCCAAGGATGGG - Intergenic
1100295080 12:93253707-93253729 AAATCTTACCAGCCAAGTTTCGG - Intergenic
1108478191 13:50842242-50842264 ATTCTGTACAAGCCAAGGTTTGG - Intronic
1110001445 13:70208025-70208047 ACAGTTTTCCAGCCAACTTTTGG - Intergenic
1110113096 13:71775852-71775874 ACTCTTTGCCAGCCAAGTGTAGG + Intronic
1111053683 13:82920050-82920072 ACACTTTAACAGAGAAGCTTGGG + Intergenic
1120496253 14:85240114-85240136 ACCCTTCAGCAGCCATGGTTGGG - Intergenic
1125884937 15:43221483-43221505 ACCCTCTACCAGAGAAGGTTGGG + Intergenic
1131051553 15:89351539-89351561 ACAGGATACCAACCAAGGTTTGG - Intergenic
1145377695 17:22366308-22366330 ACACTTGAACAGCCAATGATGGG + Intergenic
1145824509 17:27866747-27866769 ACTCTCTATCAGCCAGGGTTTGG + Intronic
1148826269 17:50396698-50396720 ACAGTTTACCAGCCAAGCTGGGG + Intronic
1150987591 17:70215390-70215412 AAACTTTACCAGCCACTGTAAGG - Intergenic
1153366639 18:4264651-4264673 CCATTTTAGCAGCCAAGGATGGG + Intronic
1156781352 18:40854367-40854389 ACAACCTAGCAGCCAAGGTTTGG + Intergenic
1165575098 19:36808711-36808733 ACACTTTAACAGCCAAGGATGGG - Intergenic
1165599764 19:37044214-37044236 ACATTTTAACAGCCAAGGATGGG + Intronic
932713222 2:74082936-74082958 ACACTGTACCAGGCAGGGTGGGG - Intronic
932912288 2:75818407-75818429 ACACATAAACTGCCAAGGTTTGG + Intergenic
935844579 2:107151267-107151289 ACACTTTACGAGGCAAGGAACGG + Intergenic
937757904 2:125563074-125563096 ATCCTTTACCAGTCAAGGTATGG + Intergenic
941138304 2:161745042-161745064 AGACTTTCCCAGACAAAGTTGGG - Intronic
944464266 2:199984413-199984435 ACTCTTGACAAGCCAAGGATAGG - Intronic
1170490255 20:16865177-16865199 AGAATTTACCAGTCAATGTTGGG + Intergenic
1171189392 20:23148252-23148274 TCACTTGGCCAGCCAGGGTTTGG + Intergenic
1171286371 20:23942301-23942323 ACACTTTCCCATCCAATGTAAGG + Intergenic
1171525579 20:25807656-25807678 ACACTTGAACAGGCAAGGATGGG - Intronic
1171534777 20:25877573-25877595 ACACTTGAACAGCCAAGGATGGG - Intergenic
1171551248 20:26048228-26048250 ACACTTGAACAGGCAAGGATGGG + Intergenic
1171792249 20:29538015-29538037 ACACTTGAACAGCCAAGGATGGG + Intergenic
1171806297 20:29683348-29683370 ACATTTGAACAGCCAAGGATGGG + Intergenic
1171837760 20:30173064-30173086 ACATTTGAACAGCCAAGGATGGG - Intergenic
1171856107 20:30344932-30344954 ACACTTGAACAGCCAAGGATGGG - Intergenic
1173239057 20:41277176-41277198 AAAGTTTACCAGGCAAGGTGGGG + Intronic
1177509349 21:22063829-22063851 ACATTTTATCAGCCAATATTGGG + Intergenic
1180574147 22:16757125-16757147 ACATTTGAACAGCCAAGGATGGG - Intergenic
1182128204 22:27831663-27831685 ACAGTGTACCAGGCAGGGTTAGG - Intergenic
949315105 3:2744755-2744777 ACATTTTAACAGCGAAGTTTTGG - Intronic
950370842 3:12528908-12528930 CCATTTTACCATGCAAGGTTCGG + Exonic
953301913 3:41786051-41786073 ACACATTATTAGCCTAGGTTAGG - Intronic
956166092 3:66399374-66399396 AAACTTCACCACCCAAGGGTTGG - Intronic
965496600 3:169406012-169406034 AGACTTTCCTAGCCATGGTTAGG + Intronic
967090961 3:186134439-186134461 AGACTTTACCAGCCATGATTGGG - Intronic
978137087 4:105275539-105275561 ACACTTTACCAGCCAAGGTTTGG + Exonic
978375284 4:108068661-108068683 TCACTTTACTGGTCAAGGTTTGG - Intronic
984899302 4:184570487-184570509 ACACTTGAACAGCCAAGGATGGG + Intergenic
985852172 5:2396959-2396981 ACACTTGGGCAGCCAAGGTCTGG + Intergenic
987279156 5:16394877-16394899 ACCCTCCACCAGCAAAGGTTAGG - Intergenic
988996313 5:36718112-36718134 ATCCTTGACCAGCCAAGGATGGG + Intergenic
989777674 5:45228546-45228568 ACACTATACTAGACAAGGTAGGG - Intergenic
991283603 5:64943872-64943894 ACTCTTTGCCAGCCAGTGTTTGG - Intronic
993158618 5:84259247-84259269 AGACTTTACCAGACCAGGTGTGG - Intronic
995391309 5:111642733-111642755 AGACTTTTCCACCCAAGTTTTGG - Intergenic
996606199 5:125326412-125326434 ACCCTCTTCCAGGCAAGGTTAGG + Intergenic
998580171 5:143365000-143365022 TCATTTTAACAGCCTAGGTTGGG - Intronic
998884677 5:146681791-146681813 ACCATTTAACAACCAAGGTTAGG + Intronic
1005796809 6:29372028-29372050 ACACTGTACAAGACAGGGTTGGG + Intronic
1005809025 6:29502274-29502296 GCACTTTTCAACCCAAGGTTAGG - Intergenic
1008982713 6:57503344-57503366 ATACTTTCCCAACAAAGGTTTGG - Intronic
1009170785 6:60396207-60396229 ATACTTTCCCAACAAAGGTTTGG - Intergenic
1017550431 6:155500123-155500145 TCTCTTTTCAAGCCAAGGTTGGG - Intergenic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1019831719 7:3336774-3336796 ACACTTTCCCAGCCAAAGTGTGG - Intronic
1024189863 7:46994806-46994828 ACACTTTTCCAGCAAAGACTTGG - Intergenic
1025286267 7:57664526-57664548 ACAATTGAACAGCCAAGGATGGG - Intergenic
1025299892 7:57810436-57810458 ACAATTGAACAGCCAAGGATGGG + Intergenic
1026642631 7:72140582-72140604 ACACCCTGCCTGCCAAGGTTGGG - Intronic
1027407515 7:77877440-77877462 ACAGTTCATCATCCAAGGTTAGG + Intronic
1030017343 7:105237167-105237189 ACACCTTTCCAGACAGGGTTTGG - Intronic
1030818552 7:114067565-114067587 ACACTTTACCTTCCAGTGTTAGG + Intronic
1031291692 7:119945721-119945743 ACAATTGACCAGCCTAAGTTTGG + Intergenic
1040542918 8:48376023-48376045 ACACTGTACCAGCAAAGCTAGGG - Intergenic
1045246741 8:100448650-100448672 CCACTTTTCCAGCCTAAGTTAGG + Intergenic
1047205877 8:122802742-122802764 TCACTTTACCAGCCAGGCGTTGG - Intronic
1047257713 8:123228216-123228238 CCACTGTACCAGCCTAGGTCAGG + Intronic
1048906311 8:139092794-139092816 CCCCTTTACCTGCCAGGGTTTGG + Intergenic
1052780709 9:32779714-32779736 ACACTTTACCAGCCAGCATGTGG + Intergenic
1053793701 9:41705567-41705589 ACACTTGAACAGCCAAGGATGGG - Intergenic
1054151473 9:61609263-61609285 ACACTTGAACAGCCAAGGATGGG + Intergenic
1054471247 9:65540402-65540424 ACACTTGAACAGCCAAGGATGGG + Intergenic
1058551445 9:106119843-106119865 ACATTTTACCAGCAAAGGAATGG - Intergenic
1059729955 9:117046935-117046957 TCACTTTTCCTGGCAAGGTTTGG + Intronic
1186460978 X:9748521-9748543 ACACATTATGAGCCAAGGATGGG + Intronic
1197640749 X:128965566-128965588 ACACTTTACCAACCAACTTTTGG + Intergenic