ID: 978142016

View in Genome Browser
Species Human (GRCh38)
Location 4:105328869-105328891
Sequence CTACAATTGAAAATGGTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978142016_978142020 22 Left 978142016 4:105328869-105328891 CCATTAACCATTTTCAATTGTAG No data
Right 978142020 4:105328914-105328936 TCTTCGAATACAGCCTCTGTAGG No data
978142016_978142021 26 Left 978142016 4:105328869-105328891 CCATTAACCATTTTCAATTGTAG No data
Right 978142021 4:105328918-105328940 CGAATACAGCCTCTGTAGGCAGG No data
978142016_978142018 -5 Left 978142016 4:105328869-105328891 CCATTAACCATTTTCAATTGTAG No data
Right 978142018 4:105328887-105328909 TGTAGCATGCACAAGAGAGCTGG No data
978142016_978142019 -1 Left 978142016 4:105328869-105328891 CCATTAACCATTTTCAATTGTAG No data
Right 978142019 4:105328891-105328913 GCATGCACAAGAGAGCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978142016 Original CRISPR CTACAATTGAAAATGGTTAA TGG (reversed) Intergenic