ID: 978142017

View in Genome Browser
Species Human (GRCh38)
Location 4:105328876-105328898
Sequence GTGCATGCTACAATTGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978142017_978142021 19 Left 978142017 4:105328876-105328898 CCATTTTCAATTGTAGCATGCAC No data
Right 978142021 4:105328918-105328940 CGAATACAGCCTCTGTAGGCAGG No data
978142017_978142019 -8 Left 978142017 4:105328876-105328898 CCATTTTCAATTGTAGCATGCAC No data
Right 978142019 4:105328891-105328913 GCATGCACAAGAGAGCTGGATGG No data
978142017_978142020 15 Left 978142017 4:105328876-105328898 CCATTTTCAATTGTAGCATGCAC No data
Right 978142020 4:105328914-105328936 TCTTCGAATACAGCCTCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978142017 Original CRISPR GTGCATGCTACAATTGAAAA TGG (reversed) Intergenic