ID: 978142021

View in Genome Browser
Species Human (GRCh38)
Location 4:105328918-105328940
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978142016_978142021 26 Left 978142016 4:105328869-105328891 CCATTAACCATTTTCAATTGTAG No data
Right 978142021 4:105328918-105328940 CGAATACAGCCTCTGTAGGCAGG No data
978142017_978142021 19 Left 978142017 4:105328876-105328898 CCATTTTCAATTGTAGCATGCAC No data
Right 978142021 4:105328918-105328940 CGAATACAGCCTCTGTAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr