ID: 978143828

View in Genome Browser
Species Human (GRCh38)
Location 4:105348567-105348589
Sequence GGATGCATCAAGTCTCACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978143828_978143832 13 Left 978143828 4:105348567-105348589 CCTCAGTGAGACTTGATGCATCC No data
Right 978143832 4:105348603-105348625 AGTTATCTTTACTCCCCCGCAGG No data
978143828_978143838 27 Left 978143828 4:105348567-105348589 CCTCAGTGAGACTTGATGCATCC No data
Right 978143838 4:105348617-105348639 CCCCGCAGGGAGGGCCCTCTAGG No data
978143828_978143833 14 Left 978143828 4:105348567-105348589 CCTCAGTGAGACTTGATGCATCC No data
Right 978143833 4:105348604-105348626 GTTATCTTTACTCCCCCGCAGGG No data
978143828_978143834 17 Left 978143828 4:105348567-105348589 CCTCAGTGAGACTTGATGCATCC No data
Right 978143834 4:105348607-105348629 ATCTTTACTCCCCCGCAGGGAGG No data
978143828_978143835 18 Left 978143828 4:105348567-105348589 CCTCAGTGAGACTTGATGCATCC No data
Right 978143835 4:105348608-105348630 TCTTTACTCCCCCGCAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978143828 Original CRISPR GGATGCATCAAGTCTCACTG AGG (reversed) Intergenic
No off target data available for this crispr