ID: 978144775

View in Genome Browser
Species Human (GRCh38)
Location 4:105359530-105359552
Sequence GCAGAGTTGTTTGTTCCAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978144775_978144778 17 Left 978144775 4:105359530-105359552 CCGGTTGGAACAAACAACTCTGC No data
Right 978144778 4:105359570-105359592 GCTGTAACACTCACTTGCAAAGG No data
978144775_978144779 24 Left 978144775 4:105359530-105359552 CCGGTTGGAACAAACAACTCTGC No data
Right 978144779 4:105359577-105359599 CACTCACTTGCAAAGGTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978144775 Original CRISPR GCAGAGTTGTTTGTTCCAAC CGG (reversed) Intergenic
No off target data available for this crispr