ID: 978145683

View in Genome Browser
Species Human (GRCh38)
Location 4:105368648-105368670
Sequence TTGTTCAAGAATAAGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978145679_978145683 27 Left 978145679 4:105368598-105368620 CCATAAGATTTCAAGGCTTCAAG 0: 1
1: 0
2: 0
3: 20
4: 124
Right 978145683 4:105368648-105368670 TTGTTCAAGAATAAGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978145683 Original CRISPR TTGTTCAAGAATAAGGAGAA AGG Intergenic
No off target data available for this crispr