ID: 978148088

View in Genome Browser
Species Human (GRCh38)
Location 4:105400791-105400813
Sequence AATATCTACCTCAGTCTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978148086_978148088 5 Left 978148086 4:105400763-105400785 CCAAGGAGAAAGAGAAAGCTAAT 0: 1
1: 0
2: 6
3: 60
4: 597
Right 978148088 4:105400791-105400813 AATATCTACCTCAGTCTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978148088 Original CRISPR AATATCTACCTCAGTCTAGG AGG Intronic
No off target data available for this crispr