ID: 978148775

View in Genome Browser
Species Human (GRCh38)
Location 4:105409603-105409625
Sequence CTGCCAGTCCGGCTACATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1173
Summary {0: 1, 1: 0, 2: 41, 3: 271, 4: 860}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978148775_978148786 15 Left 978148775 4:105409603-105409625 CCCCCATGTAGCCGGACTGGCAG 0: 1
1: 0
2: 41
3: 271
4: 860
Right 978148786 4:105409641-105409663 GGCCGACAGACACCTCATACAGG 0: 107
1: 573
2: 1052
3: 814
4: 574
978148775_978148781 -7 Left 978148775 4:105409603-105409625 CCCCCATGTAGCCGGACTGGCAG 0: 1
1: 0
2: 41
3: 271
4: 860
Right 978148781 4:105409619-105409641 CTGGCAGACACCTCCCAGTAGGG 0: 6
1: 713
2: 1261
3: 2231
4: 3468
978148775_978148782 -6 Left 978148775 4:105409603-105409625 CCCCCATGTAGCCGGACTGGCAG 0: 1
1: 0
2: 41
3: 271
4: 860
Right 978148782 4:105409620-105409642 TGGCAGACACCTCCCAGTAGGGG 0: 8
1: 714
2: 1229
3: 2318
4: 3285
978148775_978148788 18 Left 978148775 4:105409603-105409625 CCCCCATGTAGCCGGACTGGCAG 0: 1
1: 0
2: 41
3: 271
4: 860
Right 978148788 4:105409644-105409666 CGACAGACACCTCATACAGGTGG 0: 40
1: 177
2: 341
3: 377
4: 618
978148775_978148789 19 Left 978148775 4:105409603-105409625 CCCCCATGTAGCCGGACTGGCAG 0: 1
1: 0
2: 41
3: 271
4: 860
Right 978148789 4:105409645-105409667 GACAGACACCTCATACAGGTGGG 0: 46
1: 179
2: 369
3: 580
4: 1198
978148775_978148791 30 Left 978148775 4:105409603-105409625 CCCCCATGTAGCCGGACTGGCAG 0: 1
1: 0
2: 41
3: 271
4: 860
Right 978148791 4:105409656-105409678 CATACAGGTGGGTGCCCCTCTGG 0: 75
1: 171
2: 274
3: 237
4: 276
978148775_978148780 -8 Left 978148775 4:105409603-105409625 CCCCCATGTAGCCGGACTGGCAG 0: 1
1: 0
2: 41
3: 271
4: 860
Right 978148780 4:105409618-105409640 ACTGGCAGACACCTCCCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978148775 Original CRISPR CTGCCAGTCCGGCTACATGG GGG (reversed) Intronic
900039105 1:441925-441947 CTCCCAGTCAGGATACACGGGGG - Intergenic
900060538 1:676901-676923 CTCCCAGTCAGGATACACGGGGG - Intergenic
902134209 1:14291115-14291137 CTCCCTGTTAGGCTACATGGGGG + Intergenic
904363594 1:29995534-29995556 CTCCCAGTTAGGCTACACGGGGG - Intergenic
905840878 1:41176967-41176989 CTCCCAGTTAGGCTACTTGGGGG - Intronic
905897031 1:41554925-41554947 CTCCCAGTTAGGCTACACGGGGG + Intronic
906361423 1:45163038-45163060 CTCCCAGTTAGGCTACTTGGGGG - Intronic
906570096 1:46830604-46830626 CTCCCAGTTAGGCTACATGGGGG + Intergenic
906571676 1:46846835-46846857 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
906584490 1:46964661-46964683 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
906605442 1:47166623-47166645 CTACCAGTTAGGCTACTTGGGGG - Intergenic
906834978 1:49073705-49073727 CTCCCAGTCAGGCTACTCGGGGG + Intronic
906843017 1:49160504-49160526 CTCCCAGTCAGGAGACATGGGGG + Intronic
906893010 1:49738624-49738646 CTCCCAGTTAGGCTACTTGGGGG - Intronic
907050429 1:51326424-51326446 CTGCAAGGCCAGCTAAATGGAGG + Intronic
908595565 1:65685595-65685617 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
908813491 1:68008522-68008544 CTACCAGTTAGGCTACAAGGGGG + Intergenic
908876815 1:68686916-68686938 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
909261225 1:73491603-73491625 CTCCCAGTTTGGCTACACGGGGG + Intergenic
909301185 1:74015051-74015073 CTCCCAGTCAGGCTACATGGGGG - Intergenic
909449057 1:75778282-75778304 CTCCCAGTTAGGCTACACGGGGG - Intronic
909453966 1:75829504-75829526 CTCCCAGTTAGGCTACTTGGGGG - Intronic
909557483 1:76969739-76969761 CTCCCAGTTAGGCTACACGGGGG - Intronic
909558418 1:76981699-76981721 CTCCCAGTTAGGCTACAAGGGGG - Intronic
909707857 1:78608377-78608399 TTCCCAGTCAGGCTACACGGGGG - Intergenic
910281780 1:85509032-85509054 CTCCCAGTTAGGCTACACGGGGG - Intronic
910383646 1:86658133-86658155 CTCCCAGTTAGGCTACATGGGGG - Intergenic
910717440 1:90247668-90247690 CTCCCAGTTAGGCTACACGGGGG - Intergenic
910829174 1:91442503-91442525 CTCCCAGTTAGGCTACACGGTGG - Intergenic
910925027 1:92389102-92389124 CTCCCAGTCAGGCTACACGGGGG - Exonic
910956913 1:92716174-92716196 CTCCCAGTTAGGCTACATGGGGG - Intronic
911079644 1:93916055-93916077 CTCCCAGTTAGGCTACATGGGGG + Intergenic
911120596 1:94292890-94292912 CTCCCAATCAGGCTACACGGGGG + Intergenic
911342128 1:96651943-96651965 CTCCCAGTTAGGCTACATGGGGG - Intergenic
911596073 1:99800321-99800343 CTCCCAGTCAGGCTACACAGGGG + Intergenic
911676868 1:100668400-100668422 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
911689860 1:100820663-100820685 CTCCCAGTCAGGCTACACAGGGG - Intergenic
911700737 1:100949443-100949465 CTCCCAGTTAGGCTTCATGGGGG + Intronic
911941934 1:104057748-104057770 CGCCCAGTCAGGATACATGGGGG - Intergenic
911954990 1:104222488-104222510 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
912110053 1:106330109-106330131 CTCCCAGTTAGGCTACTTGGTGG - Intergenic
912225828 1:107732925-107732947 CTCCCAGTTAGGCTACATGGGGG - Intronic
912613991 1:111078934-111078956 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
912646211 1:111394446-111394468 CTCCCAGTTAGGCTACATGGGGG - Intergenic
913081185 1:115388754-115388776 CTCCCAGTTAGGCTACACGGAGG + Intergenic
913363079 1:118004246-118004268 CTCCCAGTTAGGCTACACGGGGG + Intronic
913407979 1:118517227-118517249 CTCCCAGTTAGGCTACGTGGGGG + Intergenic
913467351 1:119156694-119156716 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
913512526 1:119574569-119574591 TTTCCAGTCAGGCTACATGGGGG - Intergenic
913607445 1:120478868-120478890 CTCCCAGTTAGGCTACACGGTGG - Intergenic
913721769 1:121603593-121603615 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
913987901 1:143582707-143582729 CTCCCAGTCAGGCTATATGGTGG + Intergenic
914208981 1:145561271-145561293 CTCCCAGTTAGGCTACACGGTGG + Intergenic
914369193 1:147007222-147007244 CTCCCAGTTAGGCTACATGGTGG - Intergenic
914562647 1:148835856-148835878 CTCCCAGTTAGGCTACTTGGGGG + Intronic
914583747 1:149042966-149042988 CTCCCAGTTAGGCTACACGGTGG + Intronic
914610182 1:149294366-149294388 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
915077289 1:153319735-153319757 CTCCCAGTCAGGCTACACAGGGG + Intergenic
915651608 1:157315965-157315987 CTCCCAGTCAGGCTACACGGGGG - Intergenic
915757774 1:158279472-158279494 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
915807047 1:158865015-158865037 TTCCCAGTCAGGCTACACGGGGG - Intergenic
915894019 1:159797232-159797254 CTGCCAGTCTGGCTAAATCTTGG - Intergenic
916460740 1:165021840-165021862 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
916469463 1:165108981-165109003 CTCCCAGTCAGGCTACACAGGGG + Intergenic
916534536 1:165691077-165691099 CTCCCAGTTAGGCTACTTGGGGG - Intronic
917041643 1:170811447-170811469 CTCCCAGTTAGGCTACATGGGGG - Intergenic
917175524 1:172231141-172231163 CTCCCAGTTAGGCTACTTGGCGG + Intronic
917192464 1:172432303-172432325 CTCCCAGTTAGGCTACCTGGGGG - Intronic
917207861 1:172596710-172596732 CTCCCAGTTAGGCTACACGGGGG + Intronic
917573633 1:176296523-176296545 CTCCCAGTTAGGCTACACGGGGG + Intergenic
917579115 1:176356549-176356571 CTCCCAGTCAGCCTACATGGGGG - Intergenic
917827450 1:178838243-178838265 CTCCCAGTTAGGCTACTTGGGGG - Intronic
917900731 1:179540647-179540669 CTCCCAGTCAGGCTACACGGGGG + Intronic
918541573 1:185638335-185638357 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
918616535 1:186550741-186550763 CTCCCAGTCAGGCTACACAGGGG + Intergenic
918890297 1:190257914-190257936 CTCTCAGTTAGGCTACATGGGGG + Intronic
918906731 1:190505835-190505857 CTCCCAGTCAGGATACACGGGGG + Intergenic
918973339 1:191448192-191448214 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
919063876 1:192668372-192668394 CTCCCAGTCAGGCTACACGGAGG + Intergenic
919377913 1:196817373-196817395 CTCCCAGTTAGGCTACATAGGGG + Intergenic
919387601 1:196941398-196941420 CTCCCAGTTAGGCTACATGGGGG + Intronic
919456766 1:197829839-197829861 CTCCCAGTTAGGCTACGTGGCGG - Intergenic
920064463 1:203257170-203257192 CTCCCAGTTAGGCTACATGGGGG - Intronic
920085456 1:203412177-203412199 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
920428737 1:205900109-205900131 CTCCCAGTCAGGCTACACAGCGG - Intergenic
921401317 1:214727137-214727159 CTCCTAGTCAGGATACATGGGGG + Intergenic
921626250 1:217380349-217380371 CTGCCAGTCAGGAGGCATGGGGG - Intergenic
921846368 1:219887412-219887434 CTCCCAGTTAGGCTACTTGGGGG - Intronic
921915976 1:220611006-220611028 CTCCCAGTTAGGCTACATGGGGG + Intronic
921943076 1:220863575-220863597 CTCCCAGTCAGGATACATGGGGG + Intergenic
922186439 1:223278785-223278807 CTCCCAGTTAGGCTACTTGGGGG - Intronic
922383810 1:225060935-225060957 CTCCCAGTTAGGCTACTTGGGGG + Intronic
922824278 1:228506378-228506400 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
922826640 1:228526109-228526131 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
923081334 1:230658506-230658528 CTCCCAGTCAGGATACACGGGGG + Intronic
923690840 1:236191780-236191802 CTCCCAGTCAGGATACATGGGGG + Intronic
923853499 1:237821211-237821233 CTCCCAGTCAGGATACATGGGGG - Intronic
923947175 1:238900853-238900875 CTCCCAGTCAGGCTACATGGGGG - Intergenic
924247467 1:242098981-242099003 CTCCCAGTTAGGCTACTTGGGGG + Intronic
924253323 1:242157769-242157791 CTCCCAGTCAGGATACATGGCGG + Intronic
924296086 1:242587635-242587657 CTCCCAGTCAGGAGACATGGGGG - Intergenic
1064208087 10:13341834-13341856 CTGTCATTCCAGCTACTTGGAGG + Intronic
1064492830 10:15877949-15877971 CTCCCAGTCAGGCTACATGGGGG + Intergenic
1064518595 10:16177024-16177046 CTCCCAGTTAGGCTACATGGGGG + Intergenic
1065074319 10:22061418-22061440 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1065119324 10:22513679-22513701 CTCCCAGTCACGCTACATGGGGG + Intergenic
1065231003 10:23598541-23598563 CTCCCAGTTAGGCTACATGGGGG + Intergenic
1065364640 10:24923361-24923383 CTCCCAGTCAGGCTAAATGGGGG - Intronic
1065427493 10:25620199-25620221 CTCCCAGTCAGGATACACGGGGG - Intergenic
1065594823 10:27299948-27299970 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1065606081 10:27418966-27418988 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1065815477 10:29479175-29479197 CTGTGAGTCTGGCTACAAGGAGG - Intronic
1066060425 10:31719097-31719119 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1066297595 10:34068186-34068208 CTCCCAGTCAGGCAACATGGGGG - Intergenic
1066503060 10:36013538-36013560 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1066993424 10:42539167-42539189 CTCCCAGTCAGGAGACATGGGGG + Intergenic
1067127566 10:43532914-43532936 CTCCCAGTTAGGCTACATGGGGG + Intergenic
1067149398 10:43717405-43717427 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1067172525 10:43920204-43920226 CTCCAAGTTAGGCTACATGGGGG + Intergenic
1067193397 10:44091598-44091620 CTCCAAGTTAGGCTACATGGGGG - Intergenic
1067325949 10:45266502-45266524 TTTCCAGTCAGGCTACACGGGGG - Intergenic
1067810665 10:49425041-49425063 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1067869344 10:49942694-49942716 CTGCCCTTACGGCTACTTGGAGG - Intronic
1068169120 10:53370793-53370815 CTCCCAGTCAGGCTACACGGCGG - Intergenic
1068214724 10:53968570-53968592 CTCCCAGTTAGGCTACTTGGGGG - Intronic
1068413239 10:56684524-56684546 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1068495395 10:57779543-57779565 TTCCCAGTTGGGCTACATGGGGG - Intergenic
1068534858 10:58230365-58230387 CTCCCAGTTAGGCTACACGGGGG - Intronic
1068567664 10:58593426-58593448 CTCCCAGTCAGGATACAAGGGGG - Intronic
1068609485 10:59043290-59043312 CTCCCAGTTAGGCTACATGATGG + Intergenic
1069188960 10:65463851-65463873 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1070007223 10:72436101-72436123 CTCCCAGTTAGGCTACATGGGGG - Intronic
1071421465 10:85504500-85504522 CTCCCAGTTAGGCTACACGGGGG + Intergenic
1071698440 10:87903280-87903302 CTCCCAGTTAGGCTACAAGGGGG + Intronic
1071838620 10:89445293-89445315 CTCCCAGTTAGGCTACACGGGGG - Intronic
1072243702 10:93521664-93521686 CTCCCAGTTAGGCTACACGGGGG - Intronic
1072245033 10:93535683-93535705 CTCCCAGTCAGGCTACATGGGGG - Intergenic
1072370138 10:94757857-94757879 CTCCCAGTTAGGCTACATGGGGG + Intronic
1072477570 10:95777585-95777607 CTCCCAGTTAGGCTACATGGGGG + Intronic
1072480508 10:95806941-95806963 CTCCCAGTTAGGCTACATGGGGG + Intronic
1072775019 10:98182468-98182490 CTCCCAGTTAGGCTACATGGGGG + Intronic
1072872367 10:99133424-99133446 CTCCCAGTCAGGATACATAGAGG - Intronic
1072929159 10:99645984-99646006 CTCCCAGTTAGGCTACTTGGAGG + Intergenic
1073668145 10:105556541-105556563 CTCCGAGTCCAGTTACATGGGGG + Intergenic
1073694551 10:105850042-105850064 CTCCCAGTTAGGCTACATGAGGG - Intergenic
1073927412 10:108533152-108533174 CTCCAAGTTAGGCTACATGGAGG - Intergenic
1073940704 10:108694448-108694470 CTCCTAGTCAGGCTACATGGGGG - Intergenic
1073998073 10:109339058-109339080 CTCCCAGTCAGGCTACATGTGGG + Intergenic
1074017185 10:109546024-109546046 CTCCCAGTTAGGCTACATGGGGG - Intergenic
1074027677 10:109653066-109653088 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1074179272 10:111043845-111043867 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1074240906 10:111637813-111637835 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1074399236 10:113128160-113128182 CTGCCATTCCCTTTACATGGTGG - Intronic
1074408075 10:113197940-113197962 CTGCCATTGCTGCTATATGGTGG - Intergenic
1074464880 10:113672121-113672143 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1074631414 10:115259051-115259073 CTGCCAGTTAGGCTACACGGGGG + Intronic
1076965317 11:77834-77856 CTCCCAGTCAGGATACACGGGGG - Intergenic
1077697314 11:4406213-4406235 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1078032277 11:7764808-7764830 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1078336425 11:10466727-10466749 CTCCCAGTCAGGATACACGGGGG - Intronic
1078394105 11:10963906-10963928 CTCCCAGTTAGGCTACACGGGGG - Intergenic
1078560459 11:12366657-12366679 TTCCCAGTCAGGCTACACGGGGG - Intergenic
1078690049 11:13570530-13570552 CTCCCAGTCAGGCTACACGAGGG - Intergenic
1078697809 11:13651957-13651979 CTCCCAGTCAGGCTACACGGGGG - Intergenic
1078814049 11:14801588-14801610 CTTCCAGTCAGGATACATGGGGG + Intronic
1078981211 11:16537015-16537037 CTCCCAATCAGGCTACATGGGGG - Intronic
1078994091 11:16679172-16679194 CTCCCAGTCAGGCTACACAGGGG - Intronic
1079337804 11:19586800-19586822 CTCCCAGTTAGGCTACTTGGGGG + Intronic
1079510503 11:21205065-21205087 CTCCCAGTCAGGAGACATGGGGG + Intronic
1079957525 11:26882881-26882903 CTCCCAGTTAGGCTACACGGGGG - Intergenic
1080235802 11:30067057-30067079 CTCCCAGTTAGGCTACACGGGGG + Intergenic
1080743993 11:35091340-35091362 CTGCCAGTTAGGCTACACGGGGG - Intergenic
1081308770 11:41545398-41545420 CTCCCAGTTAGGCTACATGTGGG - Intergenic
1081324560 11:41728722-41728744 CTCCCAGTTAGGCTACATGGGGG + Intergenic
1081454349 11:43206654-43206676 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1081585621 11:44381829-44381851 CTGCCAGCCAGGCTTGATGGGGG - Intergenic
1081587375 11:44396644-44396666 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1081682359 11:45017236-45017258 CTCCCAGTCAGGCTACATGGGGG + Intergenic
1082103139 11:48191166-48191188 CTTCCAGTTAGGCTACTTGGGGG + Intergenic
1082107461 11:48236090-48236112 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1082123266 11:48403044-48403066 CTCCCAGTTAGGCTACTTGGTGG - Intergenic
1082127771 11:48453273-48453295 CTCCCAGTCAGGCTACATGGGGG + Intergenic
1082249649 11:49964148-49964170 CTTCCAGTCAGGCTACACTGGGG - Intergenic
1082561326 11:54624202-54624224 CTCCAAGTCAGGCTACATGGGGG + Intergenic
1082614238 11:55338926-55338948 CTCCCAGTTAGGCTACATGGGGG + Intergenic
1082906024 11:58309560-58309582 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1082945155 11:58750311-58750333 CTCCCAGTTAGGCTATATGGGGG - Intergenic
1082956587 11:58876711-58876733 CTCCCAGTTAGGCTACTTGGGGG + Intronic
1082966666 11:58972958-58972980 CTCCCAGTTAGGCTACTTGGGGG - Intronic
1082968124 11:58989373-58989395 CTCCCAGTCAGGCTACATGGGGG + Intronic
1083503403 11:63132735-63132757 CTTCCAGTCAGGCTACATGGGGG + Intronic
1085368804 11:75979298-75979320 CTCCCAGTTAGGCTACTTGGGGG + Intronic
1085800759 11:79586776-79586798 CTCCCAGTTAGGCTACACGGGGG - Intergenic
1086312229 11:85548443-85548465 CTCCCAGTCAGGATACACGGGGG + Intronic
1086757526 11:90582884-90582906 CTCCCAGTCAGGCTACTCGGCGG + Intergenic
1086967387 11:93043620-93043642 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1087004747 11:93458742-93458764 CTCCCAGTTAGGCTACACGGGGG - Intergenic
1087100520 11:94359409-94359431 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1087243466 11:95806937-95806959 CTCCCAGTTAGGCTACTTGGGGG - Intronic
1087410609 11:97786027-97786049 CCCCCAGTCAGGATACATGGGGG + Intergenic
1087545888 11:99583246-99583268 CTCCCAGTTAGGCTACTTGGGGG + Intronic
1087653988 11:100901343-100901365 CTCCCAATTAGGCTACATGGGGG + Intronic
1087925220 11:103911269-103911291 CTCCCAGTCAGGATACATGGGGG - Intronic
1088152103 11:106757806-106757828 CTCCCAGTTAGGCTACATGGGGG + Intronic
1088309145 11:108441540-108441562 CTCCCAGTTAGGCTACTTGGGGG - Intronic
1088947949 11:114534004-114534026 CTCCCAGTTAGGCTACTTGGGGG - Intronic
1089405701 11:118195655-118195677 CTGCCAGGCAGGCTGCATGCTGG - Intronic
1090322341 11:125858051-125858073 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1091421366 12:343471-343493 CTCCCAGTTAGGCTACATGAGGG - Intronic
1091424562 12:376002-376024 CTCCCAGTTAGGCTACTTGGGGG + Intronic
1091958825 12:4672916-4672938 CTCCCAGTCAGGATACACGGGGG - Intronic
1092327106 12:7544321-7544343 TTGCTAGTCAGGCTACACGGGGG - Intergenic
1092517096 12:9226137-9226159 CTCCAAGTCAGGCTACACGGGGG + Intergenic
1092581608 12:9849045-9849067 CTCCCAGTCAGGATACATGGGGG + Intergenic
1092638956 12:10482351-10482373 CTCCCAGTCAGGCGGCATGGGGG - Intergenic
1092714811 12:11377872-11377894 CTCCCAGTTAGGCTACTTGGGGG - Intronic
1093275213 12:17117056-17117078 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1093314183 12:17627949-17627971 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1093633495 12:21437715-21437737 CTGGGAGTCCGGCAGCATGGAGG + Exonic
1093673000 12:21900029-21900051 CTCCCAGTTAGGCTACTTGGGGG - Intronic
1093694830 12:22147164-22147186 CTCCCAGTCTGGAGACATGGGGG - Intronic
1093827996 12:23718800-23718822 CTGCTAATGCAGCTACATGGAGG + Intronic
1094135355 12:27119732-27119754 CTTCCAGTTAGGCTACATGGGGG + Intergenic
1094333634 12:29323466-29323488 CTCCCAGTTAGGCTACTTGGGGG - Intronic
1094453370 12:30604842-30604864 CTCCCAGTCAGGATACACGGGGG - Intergenic
1094728447 12:33147198-33147220 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1094755472 12:33463403-33463425 CTACCAGTCAGTATACATGGGGG - Intergenic
1095128383 12:38508686-38508708 CTCCCAGTCAGGCTACATGGGGG - Intergenic
1095442730 12:42254316-42254338 CTCCCAGTCAGGCTACACGGGGG + Intronic
1095483375 12:42658790-42658812 CTTCCAGTTAGGCTACTTGGGGG + Intergenic
1095661508 12:44742029-44742051 CTCCCAGTTAGGCTACTTGGAGG - Intronic
1095706400 12:45242001-45242023 CTCCCAGTTAGGCTACATGGGGG + Intronic
1095793760 12:46195373-46195395 TTCCCAGTCCAGCTACATGGGGG + Intronic
1095845309 12:46737667-46737689 CTCCCAGTTAGGCTACATGGGGG - Intergenic
1096030496 12:48409858-48409880 CTCCCAGTCAGGCTACACAGGGG + Intergenic
1096359696 12:50973210-50973232 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1096891669 12:54777464-54777486 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1096941919 12:55355914-55355936 CTCCCAGTCAGGCTACACAGGGG - Intergenic
1096950146 12:55459998-55460020 CTCCCACTTAGGCTACATGGGGG - Intergenic
1097139522 12:56888569-56888591 CTCCCAGTTAGGCTACACGGGGG - Intergenic
1097304319 12:58052518-58052540 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1097321591 12:58232362-58232384 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1097435497 12:59548839-59548861 CTCCCAGTCAGTATACATGGGGG + Intergenic
1097749632 12:63337581-63337603 CTCCCAGTCAGGCTACACAGGGG - Intergenic
1097758612 12:63434859-63434881 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1098151800 12:67555166-67555188 CTCCCAGTCAGGATACATGGGGG + Intergenic
1098697128 12:73573100-73573122 CTCCCAGTCAGAATACATGGTGG - Intergenic
1098859549 12:75692240-75692262 CCACCAGTCCCGCAACATGGTGG + Intergenic
1098993852 12:77095884-77095906 CTCCCAGTTAGGCTACATGGGGG + Intergenic
1099314323 12:81065392-81065414 CTCCCAGTTAGGCTACATGGGGG - Intronic
1099492114 12:83300434-83300456 CTCCCAGTCAGGATACATGGGGG - Intergenic
1099699185 12:86062060-86062082 CTCCCAGTCAGGATACGTGGGGG - Intronic
1099720588 12:86357040-86357062 CTCCCAGTTAGGCTACTTGGGGG - Intronic
1099795507 12:87394646-87394668 CTCCCAGTCAGGCTACTTGGGGG - Intergenic
1100073861 12:90754938-90754960 CTCCCAGTCAGGCTACACGGGGG + Intergenic
1100375083 12:94007744-94007766 CTCCCAGTCAGGCTACACAGGGG + Intergenic
1100381396 12:94064960-94064982 CTCCCAGTCAGGCTACACAGGGG - Intergenic
1100463488 12:94823503-94823525 CTCCCAGTTAGGCTACTTGGAGG - Intergenic
1100748690 12:97673263-97673285 CTGCCAGTTAGGCTACACGGGGG - Intergenic
1100750819 12:97696742-97696764 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1100766000 12:97866254-97866276 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1100900845 12:99238620-99238642 CTCCCAGTCAGGCTACACAGGGG - Intronic
1101314048 12:103613109-103613131 CTCCCAGTTAGGCTACTTGGGGG + Intronic
1101361864 12:104034854-104034876 CTCCCAGTTAGGCTACATGGGGG - Intronic
1101460211 12:104883771-104883793 CTCCCAGTTAGGCTACTTGGGGG + Intronic
1101628568 12:106470891-106470913 CTCCCAGTCAGGCTACACGGGGG + Intronic
1101891835 12:108723647-108723669 CTGCAAGTCTGGTCACATGGTGG - Intronic
1102974184 12:117194545-117194567 CTGCAATTCCAGCTACTTGGAGG - Intergenic
1103255386 12:119537848-119537870 CTCCCAGTGAAGCTACATGGGGG + Intronic
1103255582 12:119539147-119539169 CTCCCAGTCAGGAGACATGGCGG + Intronic
1104206290 12:126642150-126642172 CTCCCAGTTAGGCTACATGGGGG + Intergenic
1105231934 13:18504181-18504203 CTCCCAGTCAGGCTGCTTGGGGG - Intergenic
1105355179 13:19653116-19653138 CTCCCAGTCAGGAGACATGGGGG - Intronic
1105875948 13:24553830-24553852 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1106094980 13:26635942-26635964 CTCCCAGTTAGGCTACATGGGGG + Intronic
1106326275 13:28693513-28693535 CTCCCAGTCAGGCTACACGGGGG + Intergenic
1106357650 13:28999312-28999334 CTCCCAGTTAGGCTACTTGGGGG + Intronic
1106608134 13:31250899-31250921 CTCCCAGTCAGGCTACACGGGGG - Intronic
1106816922 13:33418652-33418674 CTCCCAGTTTGGCTACACGGGGG - Intergenic
1106980255 13:35271061-35271083 CTCCCAGTCAGGCTACATGGGGG - Intronic
1107270105 13:38606158-38606180 CTGCCACTGCAGCTACGTGGTGG + Intergenic
1107507310 13:41047700-41047722 CTCCCAGTTAGGCTACTTGGGGG + Intronic
1108153843 13:47564605-47564627 CTCCCAATCCGGATACATGGGGG - Intergenic
1108170386 13:47735472-47735494 CTCCCAGTTAGGCTACATGGGGG - Intergenic
1108217758 13:48201563-48201585 CTCCCAGTCAGGCTACATGGGGG - Intergenic
1108445835 13:50508456-50508478 CTCCCAGTTAGGCTACTTGGGGG + Intronic
1108471701 13:50773705-50773727 CTCCCAGTTAGGCTACATGGGGG + Intronic
1108562031 13:51653828-51653850 CTCCCAGTTAGGCTACTTGGGGG + Intronic
1108797071 13:54044536-54044558 CTCCCAGTCAGGCTACACGGAGG - Intergenic
1108865456 13:54917820-54917842 CTCCCAGTTAGGCTACATGGGGG - Intergenic
1109358632 13:61267353-61267375 CTCCCAGTTAGGCTACACGGAGG - Intergenic
1109385878 13:61628747-61628769 CTCCCAGTCAGGCTACATGGGGG + Intergenic
1109465781 13:62729650-62729672 CTCCCAGTTAGGCTACATGGGGG + Intergenic
1109615483 13:64828707-64828729 CTCCCAGTCAGGATACATGGGGG - Intergenic
1110071601 13:71184973-71184995 CTCCCAGTTAGGCTACATGGGGG - Intergenic
1110135565 13:72062984-72063006 CTCCCAGTCAGGATACACGGGGG - Intergenic
1110199659 13:72833703-72833725 CTCCCAGTCAGGATACACGGGGG + Intronic
1110699182 13:78526755-78526777 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1111375095 13:87368156-87368178 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1112131049 13:96524291-96524313 CTCCCAGTCAGGCTACACAGGGG + Intronic
1112612515 13:100969620-100969642 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1114342622 14:21760763-21760785 TTCCCAGTCAGGCTACATGGAGG - Intergenic
1114433858 14:22686695-22686717 CTCCCAGTCAGGATACATGGGGG - Intergenic
1114784895 14:25585512-25585534 TTCCCAGTCAGGCTACATGGGGG + Intergenic
1114923434 14:27362940-27362962 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1114981335 14:28168669-28168691 CTCCCAGTTAGGCTACACGGAGG - Intergenic
1115135910 14:30107644-30107666 CTCCCAGTTAGGCTACTTGGGGG - Intronic
1115792697 14:36897956-36897978 CTGCCAGTTAGGCTACTTTGGGG + Intronic
1115818495 14:37188468-37188490 CTCCCAGTCAAGCTACATGCGGG - Intergenic
1116052801 14:39825464-39825486 CTCCCAGTTAGGCTACATGGGGG + Intergenic
1116165519 14:41329802-41329824 TTCCCAGTCAGGCCACATGGGGG + Intergenic
1116236439 14:42285056-42285078 TTCCCAGTCAGGCTACAGGGGGG + Intergenic
1116398566 14:44476585-44476607 CTCCCAGTTAGGCTACTTGGAGG + Intergenic
1116401727 14:44515622-44515644 CTCCCAGTTAGGCTACACGGGGG + Intergenic
1116417210 14:44693604-44693626 CTCCCAGTCAGTATACATGGGGG - Intergenic
1116433561 14:44873263-44873285 CTCCCAGTCAGGCTACATGGGGG + Intergenic
1116729804 14:48607414-48607436 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1116792781 14:49357280-49357302 CTTCCAGTTAGGCTATATGGGGG - Intergenic
1116871509 14:50073025-50073047 CTCCCAGTTAGGCTACACGGGGG - Intergenic
1117005636 14:51418608-51418630 CTCCCAGTTAGGCTACACGGGGG + Intergenic
1117081726 14:52158457-52158479 CTCCCAGTTAGGCTACATGTGGG - Intergenic
1117115157 14:52503292-52503314 CTCCCAGTGAGGCTACTTGGGGG - Intronic
1117181518 14:53196745-53196767 CTGCCAGTCGGACGACATGCTGG + Intergenic
1117204221 14:53424449-53424471 CTCCCAGTCAGGCTACACGGAGG - Intergenic
1117856730 14:60042172-60042194 CTCCCAGTTAGGCTACTTGGGGG + Intronic
1117900589 14:60528691-60528713 TTCCCAGTCAGGCTACATGGGGG + Intergenic
1118494696 14:66296481-66296503 CTCCCAGTTAGGCTACACGGAGG - Intergenic
1119007051 14:70941553-70941575 CTCCCAGTTAGGCTACTTGGGGG + Intronic
1119930523 14:78542104-78542126 CTCCCAGTTAGGCTACACGGGGG + Intronic
1120559595 14:85974488-85974510 CTCCCAGTTAGGCTACATGGGGG + Intergenic
1120670765 14:87360145-87360167 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1120742884 14:88127653-88127675 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1121213963 14:92232862-92232884 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1121298931 14:92853528-92853550 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1121473531 14:94174510-94174532 CAGCCTGTTCGGTTACATGGAGG + Exonic
1123397226 15:19948922-19948944 CTCCCAGTTAGGCTACCTGGGGG - Intergenic
1123429186 15:20200288-20200310 CTCCCAGTCTGGAGACATGGGGG + Intergenic
1124724625 15:32145350-32145372 CTCCCAGTCAGGCTACACGGGGG + Intronic
1124885753 15:33684198-33684220 CTCCCAGTTAGGCTACATGGGGG - Intronic
1125058533 15:35391264-35391286 CTCCCAGTTAGGCTACTTGGGGG + Intronic
1125219904 15:37320657-37320679 TTCCCAGTCAGGCTACATGGGGG - Intergenic
1125352123 15:38779025-38779047 CTCCCAGTTAGGCTACATGGGGG + Intergenic
1125354482 15:38802925-38802947 CTCCCAGTCAGGCTACATAGGGG + Intergenic
1125430819 15:39591527-39591549 CTGCCAGTACGTCTACAATGTGG + Exonic
1125779450 15:42251678-42251700 CTCCCAGTTAGGCTACATGGGGG + Intronic
1126087005 15:45020530-45020552 CTCCCAGTTAGGCTACATGGGGG + Intergenic
1126476375 15:49069253-49069275 CTCCCTGTCAGGCTACATGGGGG - Intergenic
1126742132 15:51787564-51787586 CTCCCAGTCAGGCTACACGGGGG - Intronic
1126862782 15:52903073-52903095 CTCCCAGTCAGTCTACAGGGGGG - Intergenic
1126889025 15:53183943-53183965 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1126952130 15:53893308-53893330 CTCCCAGTCAGGATACACGGGGG + Intergenic
1127057198 15:55143884-55143906 CTGCCAGTTAGGCTACTCGGGGG - Intergenic
1127138048 15:55944699-55944721 CTCCCAGTTAGGCTACACGGGGG - Intronic
1127253816 15:57270999-57271021 CTCCCAGTCAGGCTACACGGGGG + Intronic
1127317813 15:57814547-57814569 CTCCCAGTCAGGATACCTGGGGG + Intergenic
1128339791 15:66813435-66813457 CTCCAAGTTAGGCTACATGGGGG + Intergenic
1128696631 15:69769706-69769728 CTCCCAGTTAGGCTACGTGGGGG - Intergenic
1129588013 15:76887867-76887889 CTCCCAGTTAGGCTACACGGGGG - Intronic
1130364516 15:83222235-83222257 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1130572238 15:85057232-85057254 CTTCCAGTTAGGCTACTTGGGGG + Intronic
1130697787 15:86147819-86147841 CTCCCAGTTAGGCTACATGGGGG - Intronic
1130798365 15:87235173-87235195 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1130800876 15:87262132-87262154 CTGCCAGTTAGGCTACACGGGGG + Intergenic
1132096492 15:98988676-98988698 CTCCCAGTCAGGATACGTGGGGG - Intronic
1132287896 15:100679017-100679039 CTCCCAGTTAGGCTACACGGGGG + Intergenic
1133956922 16:10452558-10452580 CTCCCAGTCAGGATACACGGGGG + Intronic
1134793179 16:17009669-17009691 CTCCCAGACAGGCTACACGGGGG + Intergenic
1135088174 16:19491130-19491152 CTGCAAGCCCAGCTACTTGGGGG - Intronic
1136855134 16:33649444-33649466 CTCCCAGTCTGGAGACATGGGGG - Intergenic
1137324940 16:47424868-47424890 CTCCTAGTCAGGCTACATTGGGG + Intronic
1137335666 16:47546538-47546560 CTCCAAGTTAGGCTACATGGGGG + Intronic
1137371509 16:47910573-47910595 CTCCCAGTTGGGCTACTTGGGGG - Intergenic
1137471124 16:48759403-48759425 CTCCCAGTTAGGCTACATGCGGG - Intergenic
1137890913 16:52161208-52161230 CTCCCTGTTAGGCTACATGGGGG + Intergenic
1138702451 16:58878547-58878569 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1138720414 16:59072962-59072984 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1138874814 16:60936642-60936664 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1139298914 16:65927378-65927400 CTCCCAGTTAGGCTACATGGGGG - Intergenic
1140147465 16:72325069-72325091 CTCCCAGTTAGGCTACATGGGGG - Intergenic
1142220485 16:88852071-88852093 CTCCCAGTTAGGCTACACGGGGG - Intronic
1203116716 16_KI270728v1_random:1497928-1497950 CTCCCAGTCTGGAGACATGGGGG - Intergenic
1142776770 17:2146575-2146597 CTGCCACTCAGGCTACAGTGCGG + Intronic
1142935279 17:3324780-3324802 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1144294077 17:13856183-13856205 CTCCCAGTTAGGCTACACGGGGG - Intergenic
1145716652 17:27029302-27029324 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1145738379 17:27249896-27249918 CTCCCAGTTAGGCTACATAGGGG - Intergenic
1145861264 17:28212267-28212289 CTCCCAGTCAGGCTACATGGGGG - Intergenic
1147121332 17:38337025-38337047 CTGCCAGGCCTGCTGCATGCTGG - Exonic
1147527578 17:41240606-41240628 CTCCCAGTTAGGCTACTTGGGGG - Intronic
1148052094 17:44774485-44774507 CCCCCAGTACGGCAACATGGGGG + Exonic
1149093803 17:52816856-52816878 CTCCCAGTCCGGCTACACGGGGG + Intergenic
1149191889 17:54072835-54072857 CTCCCAGTCAGGCTACATGGGGG + Intergenic
1149240184 17:54639881-54639903 CTCCCATTTAGGCTACATGGGGG - Intergenic
1149255463 17:54821340-54821362 CTCCCAGTTAGGCTACACGGGGG - Intergenic
1149359492 17:55878744-55878766 CTCCCAGTTAGGCTACACGGGGG + Intergenic
1153419255 18:4885939-4885961 TTCCCAGTCAGGCTACAGGGGGG + Intergenic
1153441321 18:5122695-5122717 CTCCCAGTCAGGCTACATGGGGG - Intergenic
1154164603 18:12005179-12005201 CTGCCTGCCCGCCTACAAGGTGG - Intronic
1154320615 18:13348494-13348516 CTCCCAGTTAGGCTACTTGGCGG + Intronic
1154401529 18:14043010-14043032 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1155350607 18:24901840-24901862 CTCCCAGTTAGGCTACCTGGCGG - Intergenic
1155386717 18:25285842-25285864 GTGGCAGTCCTGATACATGGAGG - Intronic
1155426978 18:25716854-25716876 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1155659245 18:28228428-28228450 CTCCCAGTTAGGCTACATGGGGG + Intergenic
1156368136 18:36448479-36448501 CTGCCTGGCCAGCTGCATGGAGG - Intronic
1156421674 18:36960519-36960541 CTCCCAGTCAGGCTACACAGTGG - Intronic
1157036793 18:43984673-43984695 CTCCCAGTTAGGCTACATGGGGG - Intergenic
1157355323 18:46928506-46928528 CTGCCAGTTAGGCTACTCGGGGG + Intronic
1157517455 18:48320969-48320991 CTGACAGTCTGGCCACATTGAGG - Intronic
1157695043 18:49715917-49715939 CTCCCAGTCAGGATACACGGGGG + Intergenic
1157787895 18:50502515-50502537 CTCCCAGTTAGGCTACATGGGGG + Intergenic
1158168979 18:54574921-54574943 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1159364732 18:67451038-67451060 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1160260609 18:77290794-77290816 CTACCAGTTAGGCTACATGGGGG + Intergenic
1160642121 19:147464-147486 CTCCCAGTCAGGATACACGGGGG - Intergenic
1163380288 19:16961728-16961750 CTCCCAGTTAGGCTACATGGGGG - Intronic
1163955344 19:20633207-20633229 CTCCCAGTTAGGCTACTTGGGGG + Intronic
1164085589 19:21899402-21899424 CTCCCAGTTAGGCTACAAGGGGG + Intergenic
1164091024 19:21952362-21952384 CTCCCAGTTAGGCTACATGGGGG - Intronic
1164110154 19:22149056-22149078 CTCCCAGTTAGGCTACATAGGGG - Intergenic
1164265648 19:23614115-23614137 CTCCCAGTTAGGCTACTTGGGGG - Intronic
1164394855 19:27853386-27853408 CTCCAAGTTAGGCTACATGGGGG - Intergenic
1164556239 19:29254937-29254959 CTCCCAGTTAGGCTACATGGGGG + Intergenic
1166163645 19:40970928-40970950 CTCCAAGTTAGGCTACATGGGGG + Intergenic
1166179721 19:41099222-41099244 CTCCCAGTTAGGTTACATGGGGG - Intergenic
1166240324 19:41487044-41487066 CTCCCAGTTAGGCTAGATGGGGG - Intergenic
1168170493 19:54585214-54585236 TTCCCAGTCAGGCTACACGGGGG + Intronic
925116984 2:1388132-1388154 CTCCCAGTTAGGCTACTTGGGGG + Intronic
925172800 2:1760624-1760646 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
926338817 2:11886880-11886902 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
926568717 2:14506877-14506899 CTCCCAGTTAGGCTGCATGGGGG + Intergenic
926992728 2:18697610-18697632 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
927027987 2:19089949-19089971 CTCCCAGTCATGCTACATGGGGG - Intergenic
927302015 2:21526386-21526408 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
927447051 2:23172242-23172264 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
927564128 2:24095819-24095841 CTCCTAGTTAGGCTACATGGGGG - Intronic
928462692 2:31489783-31489805 CTCCCAGGCAGGCTACATGGGGG - Intergenic
928900733 2:36315296-36315318 CTCCCAGTTAGGCTACACGGGGG + Intergenic
930143201 2:47974209-47974231 CTCCCAGTTAGGCTACACGGTGG - Intergenic
930216946 2:48707349-48707371 CTCCCAGTCAAGCTACATGGGGG + Intronic
930266901 2:49210584-49210606 CTCCCAGTTAGGCTACATCGGGG - Intergenic
930274869 2:49299158-49299180 CTCCCAGTTAGGCTACATGGGGG - Intergenic
930516051 2:52409601-52409623 CTCCCAGTCAGGATACACGGTGG + Intergenic
930598028 2:53411604-53411626 CTACCAGTTAGGCTACTTGGGGG - Intergenic
930803099 2:55462849-55462871 CTCCCAGTTAGGCTACACGGAGG - Intergenic
930908869 2:56606251-56606273 TTCCCAGTCAGGCTACACGGGGG + Intergenic
930941824 2:57022877-57022899 CTCCCAGTTAGGCTACACGGGGG - Intergenic
931305217 2:61021732-61021754 TTCCCAGTCAGGCTACACGGGGG - Intronic
931306597 2:61035029-61035051 CTCCCAGTCAGGCTACACAGGGG - Intronic
931469181 2:62520952-62520974 CTGCCAGTTCGGCTACTTGGGGG + Intergenic
931479083 2:62621842-62621864 CTCCCAGTCAGGAGACATGGGGG + Intergenic
931574746 2:63708049-63708071 CTCCCAGTTAGGCTACTTGGGGG + Intronic
931594558 2:63927219-63927241 CTCCCAGTCAGGCTGCACGGGGG - Intronic
931986138 2:67744395-67744417 CTCCCAGTTAAGCTACATGGGGG + Intergenic
932323991 2:70842883-70842905 CTCCCAGTTAGGCTACACGGGGG - Intergenic
932328053 2:70876576-70876598 CTCCCAGTTAGGCTACACGGGGG - Intergenic
932511738 2:72299976-72299998 CTCCCAGTCAGGATACATGGGGG + Intronic
932868662 2:75374323-75374345 TTCCCAGTCAGGCTACACGGAGG + Intergenic
933366673 2:81362394-81362416 CTCCCAGTTAGGCTACATGGGGG + Intergenic
933603244 2:84354626-84354648 CTCCCAGTCAGGATACACGGGGG - Intergenic
933880476 2:86664372-86664394 CTCCCAGTTAGGCTACATGGGGG - Intronic
934531648 2:95093420-95093442 CTCCCAGTTAGGCTACACGGGGG - Intronic
934617122 2:95779167-95779189 CTCCCAGTCAGGCTACACAGCGG - Intergenic
934643771 2:96045392-96045414 CTCCCAGTCAGGCTACACAGCGG + Intergenic
935256708 2:101316057-101316079 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
935273885 2:101459665-101459687 CTCCCAGTCAGGCTACGTGGGGG + Intronic
935325900 2:101936347-101936369 CTCCCAGTCAGGAGACATGGGGG - Intergenic
935843973 2:107144704-107144726 TTCCCAGTTAGGCTACATGGGGG + Intergenic
935852325 2:107235998-107236020 CTCCCAGTCAGGAGACATGGAGG - Intergenic
935982890 2:108644194-108644216 CTCCCAGTTAGGATACATGGGGG - Intronic
936172907 2:110191726-110191748 CTCCCAGTTAGGCTACTTGGGGG - Intronic
936857901 2:116982224-116982246 CTCCCAGTTAGACTACATGGGGG - Intergenic
936909926 2:117579923-117579945 CTCCCAGTTAGGCTACACGGGGG - Intergenic
937074952 2:119096426-119096448 CTCCCAGTTAGGCTACTTGGAGG - Intergenic
937189938 2:120085531-120085553 CTCCCAGTTAGGCTACTTGGGGG + Intronic
938156807 2:128948715-128948737 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
938718519 2:134043459-134043481 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
939019895 2:136946414-136946436 CTCCCAGTTAGGCTACATGGGGG + Intronic
939893718 2:147767225-147767247 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
939946988 2:148422118-148422140 CTCCCAGTCAGGATACATGGGGG - Intronic
940809219 2:158223539-158223561 CTCCCAGTTAGGCTACAGGGGGG - Intronic
940821459 2:158360357-158360379 CTCCCAGTCAGGAGACATGGGGG - Intronic
940891576 2:159041214-159041236 CTGCCAGTAAGGCTACATGGGGG + Intronic
940934517 2:159475995-159476017 CTCCCAGTCAGGATACACGGGGG + Intronic
941041406 2:160627994-160628016 CTCCCAGTCAGGCTACAATGGGG + Intergenic
941682262 2:168412495-168412517 CTCCCAGTCAGGATACACGGGGG + Intergenic
941776588 2:169399885-169399907 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
941971405 2:171355391-171355413 CTCCCAGTTAGGCTACTTGGGGG + Intronic
942065755 2:172270162-172270184 CTCCCAGTTAGGCTACATGGGGG + Intergenic
942107650 2:172649051-172649073 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
942668939 2:178352801-178352823 CTCCCAGTTAGGCTACATGGGGG - Intronic
942734304 2:179092828-179092850 CTCCCAGTCAGGCTACTTGGGGG + Intergenic
942952089 2:181732337-181732359 CTCCCAGTTAGGCTACACGGAGG - Intergenic
943125339 2:183789328-183789350 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
943262823 2:185687798-185687820 CTCCCAGTCAGACTACACGGGGG + Intergenic
943303457 2:186231035-186231057 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
943309998 2:186313479-186313501 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
943350776 2:186793687-186793709 CTCCCAGTCAGGAGACATGGGGG - Intergenic
943359585 2:186901545-186901567 CTCCCAGTTAGGCTACATGGGGG + Intergenic
943583566 2:189712309-189712331 CTCCCAGTTAGGCTACAAGGGGG - Intronic
944018652 2:195074403-195074425 CTCCCAGTCAGGCTACACGGGGG - Intergenic
944033832 2:195269146-195269168 CTCCCAGTTAGGCTACACGGTGG + Intergenic
944107013 2:196089867-196089889 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
944165036 2:196709942-196709964 CTCCCAGTTAGACTACATGGGGG + Intronic
944347460 2:198685488-198685510 TTCCCAGTCTGGATACATGGGGG - Intergenic
944421631 2:199537033-199537055 CTCCCAGTCGGGATACACGGGGG - Intergenic
944607997 2:201370301-201370323 CTCCCAGTCAGGATACACGGGGG - Intergenic
944983921 2:205153210-205153232 CTCCCAGTTAGGCTACTTGGGGG + Intronic
945116714 2:206415504-206415526 CTCCCAGTTAGGCTACATGGGGG + Intergenic
945161815 2:206899641-206899663 CTCCCAGTCAGGCTACACGGGGG + Intergenic
946455051 2:219818926-219818948 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
947056291 2:226107957-226107979 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
947275791 2:228390687-228390709 TTCCCAGTCAGGCTACACGGGGG + Intergenic
947316686 2:228866480-228866502 CTGCCAGTCCTGCCAGCTGGAGG + Intronic
947483622 2:230526118-230526140 TTCCCAGTCAGGCTACCTGGGGG - Intronic
947494042 2:230619956-230619978 TCCCCAGTCAGGCTACATGGGGG - Intergenic
948025925 2:234776166-234776188 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1168966716 20:1903083-1903105 CTGCCATTCCTCCCACATGGAGG - Intronic
1169012878 20:2265127-2265149 CTCCCAGTTAGGCTACACGGGGG - Intergenic
1169795872 20:9461969-9461991 CTCCCAGTTAGGCTACATGGGGG - Intronic
1169861728 20:10159758-10159780 TTCCCAGTCAGGCTACACGGGGG - Intergenic
1170543434 20:17411728-17411750 CTCCTAGTTAGGCTACATGGGGG - Intronic
1170752802 20:19167107-19167129 CTCCCAGTTAGGCTACTTGGTGG + Intergenic
1171194254 20:23185343-23185365 CTCCCAGTTAGGCTACATGGGGG + Intergenic
1171443481 20:25186281-25186303 CTCCCAGTCAGGCTACACGGGGG + Intergenic
1172466946 20:35162250-35162272 CTCCCAGTCAGGATACATAGGGG - Intergenic
1173301350 20:41806686-41806708 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1173543807 20:43876559-43876581 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1174224028 20:48982435-48982457 CTCCCAGTTAGGCTACATGGGGG + Intronic
1174990080 20:55500012-55500034 CACCCAGTCAGGATACATGGTGG + Intergenic
1175071437 20:56337159-56337181 CTCCCAGTTAGGCTACACGGGGG - Intergenic
1176420956 21:6514910-6514932 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1176743736 21:10631794-10631816 CTCCCAGTTAGGCTACCTGGGGG - Intergenic
1176775908 21:13132482-13132504 CTCCCAGTCAGGCTGCTTGGAGG - Intergenic
1177129729 21:17241157-17241179 CTCCCAGTCAGGAGACATGGGGG - Intergenic
1177132192 21:17272010-17272032 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1179696447 21:43123229-43123251 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1180136992 21:45868313-45868335 CTGCCTGCCCGGCTGCCTGGAGG + Intronic
1180640948 22:17299063-17299085 CTCCCAGTTAGGCTACATGAGGG + Intergenic
1181064060 22:20297388-20297410 CTGGCACTTCAGCTACATGGTGG - Intergenic
1182057814 22:27373737-27373759 CTCCCAGTTAGGCTACATGGTGG - Intergenic
1182087095 22:27568780-27568802 CTGCCAGTTTGGCAACATGCTGG + Intergenic
1182993335 22:34789409-34789431 CTCCCAGACAGGCTACTTGGGGG - Intergenic
1184264356 22:43339122-43339144 CTGCAAGCCAGGCTACAAGGGGG - Exonic
949155079 3:817183-817205 CTCCCAGTCAGGATACATAGGGG - Intergenic
949287999 3:2429504-2429526 CTCCCAGTTAGGCTACTTGGAGG + Intronic
949377729 3:3408256-3408278 CTCCCAGTCAGGATACATGGGGG - Intergenic
949450077 3:4175245-4175267 CTCCCAGTTAGGCTACACGGGGG - Intronic
949453384 3:4212115-4212137 CTCCCAGTCAGGATACACGGCGG - Intronic
949500108 3:4671639-4671661 CTGCCAGTCCTGCCACCTGAAGG + Intronic
949579883 3:5377229-5377251 CTCCCAGTCAGGCTACACGGGGG - Intergenic
949804046 3:7934873-7934895 CTCCCAGTTAGGCTACATGGGGG - Intergenic
950605013 3:14070802-14070824 CTCCCAGTTAGGCTACTTGGGGG - Intronic
950792590 3:15485321-15485343 CTCCCAGTTAGGCTACTTGGGGG + Intronic
951006176 3:17618332-17618354 CTCCCAGTTAGGCTACATGGGGG + Intronic
951237649 3:20254140-20254162 CTCCCAATCAGGATACATGGGGG + Intergenic
951389270 3:22082765-22082787 CTCCCAGTTAGGCTACACGGGGG - Intronic
951434191 3:22643057-22643079 CTCCCAGTCAGGATACATGGGGG + Intergenic
951469054 3:23035856-23035878 CTCCCAGTTAGGCTACACGGGGG + Intergenic
951672888 3:25204847-25204869 CTGCCAGTTAGGCTACTCGGGGG + Intronic
951747798 3:25998856-25998878 CTCCCAGTTAGGCTACATGGGGG + Intergenic
951751553 3:26042046-26042068 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
951759506 3:26129928-26129950 CTGCCAGTTAGGCTACACGGGGG + Intergenic
951833736 3:26959125-26959147 CTCCCAGCCAGGCTACAAGGGGG + Intergenic
952073774 3:29670968-29670990 CTCCCAGTTAGGCTACTTGGGGG - Intronic
952550507 3:34471665-34471687 CTCCCAGTTAGGCTACATGGGGG + Intergenic
952813940 3:37430792-37430814 CTCCCAGTCAGGCTACACGGGGG + Intronic
952864058 3:37839517-37839539 CTCCCAGTCAGGCTACACGGGGG - Intergenic
953219009 3:40950697-40950719 CTCCCAGTCAGGCTACACGGGGG + Intergenic
953281683 3:41564314-41564336 CTGCCAGTTAGGCTACAAGGGGG + Intronic
953522909 3:43659790-43659812 CTTCCAGTCAGGCTACATGGGGG - Intronic
954507712 3:51092698-51092720 CTCCCAGTCAGGATATATGGGGG - Intronic
954531153 3:51321012-51321034 CTCCCAGTCAGGAGACATGGGGG - Intronic
954548195 3:51456632-51456654 CTCCCAGTTAGGCTACTTGGGGG - Intronic
954571982 3:51648511-51648533 CTCCCAGTTAGGCTACATGGGGG - Intronic
954978627 3:54722848-54722870 CTCCCAGTCAGGATACATGGGGG + Intronic
955048893 3:55389427-55389449 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
955464865 3:59226284-59226306 CTCCCAGTTAGGCTACATGGGGG + Intergenic
955626439 3:60924277-60924299 CTGCCAGTTAGGCTACTCGGGGG - Intronic
956222161 3:66916008-66916030 CTCCCAGTTAGGCTACTTGGAGG - Intergenic
956301835 3:67781036-67781058 CTCCCAGTTAGGATACATGGGGG + Intergenic
956316950 3:67948508-67948530 TTCCTAGTCAGGCTACATGGGGG - Intergenic
956396571 3:68832616-68832638 CTCCCAGTCAGGCTACATGGGGG + Intronic
956442103 3:69290518-69290540 CTTCCAGTTCAGCTACTTGGTGG + Intronic
956477357 3:69636776-69636798 CTCACAGTCAGGCTATATGGGGG + Intergenic
956579721 3:70796823-70796845 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
956589429 3:70898233-70898255 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
957306764 3:78467474-78467496 CTCCCAGTTAGGCTACACGGGGG + Intergenic
957497714 3:81011600-81011622 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
957917807 3:86708795-86708817 TTCCCAGTCAAGCTACATGGGGG + Intergenic
957942023 3:87017812-87017834 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
958011282 3:87883013-87883035 CTCCCAGTTAGGCTACATGGAGG - Intergenic
958037038 3:88182634-88182656 CTCCCAGTCCGGCTACACTGGGG - Intergenic
958191707 3:90193052-90193074 CTCCCAGTTAGGCTACACGGGGG + Intergenic
958413921 3:93852214-93852236 CTCCCAGTTAGGCTACACGGGGG + Intergenic
958479776 3:94631308-94631330 CTCCAAGTTAGGCTACATGGGGG - Intergenic
958654578 3:96984475-96984497 CTCCCAGTTAGGCTACTTGGGGG + Intronic
958697642 3:97547487-97547509 CTCCCAGTTAGGCTACTTGGGGG + Intronic
958810966 3:98859444-98859466 CTCCCAGTTAGGCTACTTGGGGG - Intronic
958829866 3:99073944-99073966 CTCCCAGTTAGGCTACACGGGGG + Intergenic
958835495 3:99140467-99140489 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
958861530 3:99450744-99450766 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
958957780 3:100480002-100480024 CTCCCAGTCAGGCTACACAGGGG + Intergenic
959091744 3:101910919-101910941 CTCCCAGTCAGGATACACGGGGG + Intergenic
959100946 3:102008908-102008930 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
959170787 3:102841695-102841717 CTCCCAGTCAGGCTACACAGGGG + Intergenic
959724520 3:109528646-109528668 CTTCCATTTAGGCTACATGGAGG + Intergenic
959763948 3:110001800-110001822 CTCCCACTTAGGCTACATGGGGG + Intergenic
959815869 3:110672243-110672265 TTCCCAGTCAGGCTACATGGGGG - Intergenic
960276750 3:115737923-115737945 CTCCCAGTTAGGCTACATGGGGG + Intergenic
960478850 3:118163318-118163340 CTCCCAGTTAGGCTACATGGGGG - Intergenic
960634240 3:119768112-119768134 CTGCCAGTCCTGCTGCCTGGAGG - Intergenic
960655987 3:120004479-120004501 CTCCCAGTCAGGCTACACAGGGG - Intronic
962512410 3:136114952-136114974 CTCCCAGTCAGGATACCTGGAGG - Intronic
962554040 3:136528007-136528029 CTCCCAGTTAGGCTACTTGGGGG + Intronic
962602758 3:137007220-137007242 CTCCCAGTTAGGCTACACGGGGG + Intronic
962645161 3:137431190-137431212 CTCCCAGTTAGGCTACATAGGGG - Intergenic
962656021 3:137544384-137544406 CTTCCAGTTAGGCTACATGGGGG - Intergenic
962666110 3:137654882-137654904 CTTCCAGTCAGGATACATGGGGG - Intergenic
962666745 3:137661286-137661308 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
962767017 3:138574655-138574677 CTCCCAGTTAGGCTACACGGAGG - Intronic
963048446 3:141122351-141122373 CTCCCAGTCAGGCTACACAGGGG + Intronic
963306902 3:143663002-143663024 CTCCCAGTTAGGCTACTTGGGGG - Intronic
963689298 3:148478579-148478601 CTCCCAGTCAGGCTACATGAGGG - Intergenic
964155956 3:153584689-153584711 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
964264218 3:154875655-154875677 CTCTCAGTCAGGCTACCTGGGGG - Intergenic
964270074 3:154945852-154945874 CTCCCAGTTAGGCTACATGGTGG - Intergenic
964332656 3:155620947-155620969 CTTCCAGTCAGGATACATGGGGG - Intronic
964463746 3:156966847-156966869 CTCCCAGTTAGGCTACTTGGAGG - Intronic
964701662 3:159574543-159574565 CTCCCAGTTAGGCTACACGGGGG + Intronic
964782792 3:160359547-160359569 CTCCCAGTTAGGCTACACGGGGG - Intronic
965221449 3:165931785-165931807 CTCCCAGTCAGGCTACACAGGGG - Intergenic
966232189 3:177664604-177664626 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
966351842 3:179039272-179039294 CTCCCAGTTAGGCTACATGGAGG - Intronic
966493793 3:180556977-180556999 TTCCCAGTCAGGATACATGGGGG - Intergenic
966494168 3:180560622-180560644 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
966583105 3:181590851-181590873 CTCCCAGTTAGGCTACACGGGGG + Intergenic
966936760 3:184715536-184715558 CTGTGTGTCCGGTTACATGGTGG - Intergenic
967171107 3:186824517-186824539 CTGGCAGTCCACCTACAGGGAGG + Intergenic
968408567 4:364762-364784 CTCCCAGTTAGGCTACATAGGGG + Intronic
968860599 4:3166352-3166374 CTCCCAGTCAGGCTACATGGGGG + Intronic
969181234 4:5443895-5443917 CTGCCAGTCAGGCTGCTCGGTGG + Intronic
970182878 4:13417453-13417475 CTCCCAGTTAGGCTACATAGGGG - Intronic
970775483 4:19669276-19669298 CTCCCAGTCAGGATACAAGGGGG - Intergenic
971689455 4:29814260-29814282 CTGTAAGTCCAGCTACTTGGGGG - Intergenic
972178726 4:36439537-36439559 TCCCCAGTCAGGCTACATGGGGG + Intergenic
972261097 4:37408714-37408736 CTCCCAGTCAGGATACATAGGGG - Intronic
972317839 4:37944257-37944279 CTCCCAGTTAGGCTACTTGGGGG + Intronic
972416751 4:38848002-38848024 CTCCCAGTTAGGCTACATGGGGG - Intronic
973111757 4:46405378-46405400 CTCCCAGTCAGGCTACATGGGGG - Intronic
973312997 4:48729449-48729471 CTTCCAGTCAGGCTACACAGGGG - Intronic
973341794 4:49012923-49012945 CTCCCAGTTAGGCTACATGGGGG + Intronic
973599023 4:52522559-52522581 CTCCCAGTTAGGCTACATGGTGG - Intergenic
973732294 4:53834037-53834059 CTCCCAGTTAGGCTACATGGAGG - Intronic
973835807 4:54807761-54807783 CTCCCAGTTAGGCTACATAGGGG - Intergenic
973871300 4:55169540-55169562 TTCCCAGTCAGACTACATGGGGG + Intergenic
973883587 4:55297839-55297861 TTCCCAGTCAGGCTACATGGGGG - Intergenic
974013472 4:56627847-56627869 CTGCCAGAGTGGCTACAAGGTGG - Intergenic
974023723 4:56713333-56713355 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
974106178 4:57472328-57472350 CTCCCAGTCAGGATACATGGGGG + Intergenic
974127570 4:57714805-57714827 CTCCAAGTCAGGCTACATGGTGG - Intergenic
974161817 4:58150227-58150249 CTCCTAGTCAGGATACATGGGGG - Intergenic
974176717 4:58334035-58334057 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
974280088 4:59780819-59780841 CTCCCAGTCAGGATACATGGGGG - Intergenic
974307031 4:60155829-60155851 CTCCCAGTCAGGATACATGGGGG + Intergenic
974491562 4:62571380-62571402 CTCCCAGTAAGGATACATGGGGG + Intergenic
974528476 4:63076796-63076818 CTCCAAGTTAGGCTACATGGGGG + Intergenic
974566950 4:63590299-63590321 CTCCCAGTCAGGCTACATGGGGG - Intergenic
974871796 4:67653239-67653261 TTCCCAGTCAGTCTACATGGGGG - Intronic
974937056 4:68420897-68420919 CTCCCAGTTAGGCTACTTGGAGG - Intergenic
974943891 4:68503624-68503646 CTCCCAGTCAGGATACACGGGGG - Intergenic
975034227 4:69661057-69661079 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
975094060 4:70437133-70437155 CTTCCAGTCAGGCTACACAGGGG + Intronic
975203312 4:71616485-71616507 CTCCCAGTTAGGCTACATGGGGG - Intergenic
975364920 4:73518266-73518288 CTCCTAGTTAGGCTACATGGGGG + Intergenic
975484114 4:74915645-74915667 CTCCCAGTCAGGAAACATGGGGG + Intergenic
975503264 4:75110533-75110555 CTCCCAGTTAGGCTACATGGGGG - Intergenic
975522359 4:75314134-75314156 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
975744589 4:77464030-77464052 CTCCCAGTTAGGCTACATGGGGG + Intergenic
975753543 4:77549771-77549793 CTCCCAGTTAGGCTACTTGGGGG + Intronic
975807227 4:78125811-78125833 CTCCCAGTCAGGCTACACGGTGG + Intronic
975821593 4:78276737-78276759 CTCCCAGTTAGGCTACTTGGGGG + Intronic
975887361 4:78981864-78981886 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
976114922 4:81715913-81715935 CTGCCGGTCAGGATACAAGGGGG - Intronic
976159623 4:82184817-82184839 CTCCCAGTCAGGCTACATGGGGG - Intergenic
976167673 4:82272457-82272479 CCCCCAGTCAGGATACATGGGGG - Intergenic
976445909 4:85129578-85129600 CTCCCAGTCAGGATACAGGGAGG + Intergenic
976449067 4:85166141-85166163 CTCCCAGTCCAGCTACATGGGGG + Intergenic
976451466 4:85195948-85195970 CTCCCAGTTAGGCTACATGGGGG + Intergenic
976477898 4:85506175-85506197 CTCCCAGTTAGGCTACATGGGGG + Intronic
977328502 4:95606920-95606942 CGGCCAGCCAGGCCACATGGTGG + Intergenic
977829763 4:101576762-101576784 CTCCCAGTTAGGCTACATGGGGG - Intronic
978020888 4:103810270-103810292 CTCCCAGTTAGGCTACAAGGGGG + Intergenic
978148775 4:105409603-105409625 CTGCCAGTCCGGCTACATGGGGG - Intronic
978197092 4:105984485-105984507 CTCCCAGTTAGGCTACTTGGGGG + Intronic
978236847 4:106471012-106471034 CTCCCAGTCAGGATACACGGGGG + Intergenic
978269831 4:106875530-106875552 TTCCCAGTCAGGCTACACGGGGG + Intergenic
978494068 4:109340290-109340312 CTCCCAGTTAGGCTACAGGGGGG - Intergenic
978517745 4:109586889-109586911 CTCCCAGTTAGGCTACACGGAGG + Intronic
978756559 4:112309170-112309192 CTCCCAGTTAGGCTACTTGGGGG + Intronic
978782933 4:112575997-112576019 CTCCCAGTTAGGCTACTTGGGGG - Intronic
979017418 4:115452144-115452166 CTCCCAGTTAGGCTACATGGTGG + Intergenic
979315331 4:119255158-119255180 CTCCCAGTCAGGCTACACAGGGG + Intronic
979487548 4:121285481-121285503 CTCCCAGTCAGGTTACACGGGGG - Intergenic
979512292 4:121567974-121567996 CTCCCAGTCAGGATACATGGGGG - Intergenic
979581429 4:122365509-122365531 CTCCCAGTCAGGCTACACGGGGG - Intergenic
979659615 4:123238389-123238411 CTCCCAGTTAGGCTACATGGGGG - Intronic
979730106 4:124013836-124013858 CTCCCAGTTAGGCTACATGGGGG + Intergenic
979750640 4:124274819-124274841 CTCCCAGTTAGGCTACATGAGGG + Intergenic
979998640 4:127463605-127463627 CTCCCAGTCAGGATACATGGGGG + Intergenic
979999741 4:127473389-127473411 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
980037770 4:127904928-127904950 CTCCCAGTCAGGCTACACAGTGG + Intergenic
980139323 4:128896256-128896278 CTCCCAGTTAGGCTACTTGGGGG - Intronic
980413774 4:132458487-132458509 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
980477239 4:133333804-133333826 CTCCCAGTCAGGCTACACGGGGG + Intergenic
980558685 4:134442578-134442600 CTCCCATTCAGGCTACATGGGGG + Intergenic
980584096 4:134789957-134789979 CTCCCAGTCAGGCTACAAGAGGG - Intergenic
980593962 4:134928503-134928525 CTCCCAGTTAGGCTACATGGGGG + Intergenic
980803611 4:137784354-137784376 CTCCCAGTCAGGCTACACGAGGG - Intergenic
981208001 4:142067041-142067063 CTCCCAGTTAGGCTACTTGGGGG - Intronic
981220727 4:142230520-142230542 CTGTAATTCCGGCTACTTGGAGG + Intronic
981512734 4:145575031-145575053 CTCCCAGTTAGGCTACACGGGGG - Intergenic
981560902 4:146047732-146047754 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
981839442 4:149094008-149094030 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
981975570 4:150723714-150723736 GTACCAGCTCGGCTACATGGGGG + Intronic
982733483 4:158980390-158980412 CTCCCAGTCAGGAGACATGGGGG - Intronic
982883320 4:160747051-160747073 CTCCCCGTTAGGCTACATGGGGG - Intergenic
983108922 4:163724431-163724453 CTCCCAGTTAGGCTACTTGGGGG + Intronic
983244386 4:165270754-165270776 CTCCCAGTCAGGCTACACAGAGG + Intronic
983681936 4:170363302-170363324 CTCCCAGTTAGGCTACTTGGTGG + Intergenic
983694375 4:170510516-170510538 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
983978707 4:173968320-173968342 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
984224475 4:177017899-177017921 CTCCCAGTTAGGCTACATGGGGG - Intergenic
984433983 4:179685113-179685135 CTCCCAGTTAGGCTACACGGGGG + Intergenic
985367314 4:189245432-189245454 CTCCCAGTCAGGCTACACGGGGG + Intergenic
985794819 5:1954123-1954145 CTCCCAGTTAGGCTACACGGGGG - Intergenic
986620690 5:9670498-9670520 ATGCCAGTGCAGCCACATGGTGG - Intronic
986655092 5:10003103-10003125 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
986656322 5:10016453-10016475 CTCCCAGTCAGGCTACATGGGGG + Intergenic
986750291 5:10780638-10780660 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
988309688 5:29541607-29541629 CTCCCAGTTAGGCTATATGGGGG + Intergenic
988416247 5:30949818-30949840 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
988975236 5:36508733-36508755 CTCCCAGTTAGGCCACATGGGGG - Intergenic
989321180 5:40135632-40135654 CTCAAAGTCTGGCTACATGGTGG + Intergenic
989337575 5:40336598-40336620 CTCCCAGTCAGGCTACACGGGGG - Intergenic
989349866 5:40474185-40474207 CTCCCAGTTAGGCTACATGGGGG + Intergenic
989390575 5:40896057-40896079 CTCCCAGTTAGGCTACATGGGGG - Intergenic
989508808 5:42259658-42259680 CTCCCAGTTAGGCTACTTGGTGG + Intergenic
989522420 5:42417852-42417874 CTCCCAGTTAGGCTACACGGGGG + Intergenic
989616477 5:43341473-43341495 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
989660514 5:43792342-43792364 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
989966396 5:50470704-50470726 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
990135691 5:52642053-52642075 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
990234371 5:53751185-53751207 CTCCCAGTTAGGCTACACGGGGG - Intergenic
990239624 5:53803490-53803512 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
990721310 5:58699397-58699419 CCTCCAGTTAGGCTACATGGGGG + Intronic
990745784 5:58958541-58958563 CTCCCAGTCAGGCTACAATGGGG + Intergenic
991128197 5:63090982-63091004 CTCCCAGTCAGGCTACATGGGGG - Intergenic
991199961 5:63980339-63980361 CTCCCATTTAGGCTACATGGGGG + Intergenic
991634669 5:68692301-68692323 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
992254810 5:74911220-74911242 CTCCCAGTCAGGATACATGGGGG + Intergenic
992280981 5:75176452-75176474 CTGCCAGTTAGGCTACTCGGGGG - Intronic
992354608 5:75967890-75967912 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
992506008 5:77388526-77388548 CTCCCAGTCAGGATACATGGGGG + Intronic
992516750 5:77501589-77501611 CTCCCAGTTAGGCTACATAGGGG - Intronic
992580890 5:78174656-78174678 CTCCCAGTTAGGCTACACGGGGG + Intronic
992899285 5:81277348-81277370 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
992908771 5:81374023-81374045 CTCCCAGTCAGGATACACGGGGG - Intronic
993345509 5:86777778-86777800 CTCCCAGTCAGGCTACACAGGGG + Intergenic
993370368 5:87085125-87085147 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
993444179 5:87991169-87991191 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
993591533 5:89801113-89801135 CTCCCAGTCAGGCTACATGGGGG - Intergenic
993674027 5:90795683-90795705 CTCCCAGTCAGGATACACGGGGG - Intronic
993688530 5:90970443-90970465 CTCCCAGTTAGGCTACTTGGGGG - Intronic
993790178 5:92198762-92198784 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
993947962 5:94137878-94137900 CTCCCAGTTAGGCTACATGGGGG + Intergenic
993984708 5:94583738-94583760 CTTCCAGTCAGGCTACACAGGGG - Intronic
994160379 5:96550119-96550141 CTCCCAGTCAGGCTACACGGGGG - Intronic
994230513 5:97306387-97306409 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
994378150 5:99038291-99038313 CTCCCAGCCAGGATACATGGGGG - Intergenic
994586485 5:101715708-101715730 CTCCCAGTTAGGCTACACGGAGG + Intergenic
994861235 5:105198579-105198601 CTCCCAGTTAGGCTACTTGGAGG - Intergenic
995108267 5:108399464-108399486 CTCCCAGTCAGGATACACGGGGG - Intergenic
995111910 5:108437884-108437906 CTCCCAGTCAGGATACACGGGGG - Intergenic
995459804 5:112390760-112390782 CTCCCAGTTAGGCTACATGGGGG - Intronic
995467497 5:112466156-112466178 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
995489792 5:112678946-112678968 GTCCCAGTTAGGCTACATGGGGG + Intergenic
995642926 5:114278280-114278302 CTCCCAGTCAGGCTACATGGGGG + Intergenic
996089947 5:119340772-119340794 CAGCCAGTCCAGCCACTTGGTGG - Intronic
996147248 5:119991568-119991590 CTCCCAGTCAGGCTGCATGGGGG + Intergenic
996420649 5:123258589-123258611 CTCCCAGTCAGGCTACACGGGGG + Intergenic
996668301 5:126086670-126086692 CCCCCAGTTAGGCTACATGGGGG - Intergenic
996935395 5:128943030-128943052 CTCCCAGTTAGGCTACTTGGGGG + Intronic
997004547 5:129803180-129803202 CTCCCCGTCAGGCTACACGGGGG + Intergenic
997115553 5:131122596-131122618 CTCCCAGTCAGGCTACACTGGGG + Intergenic
997187634 5:131898356-131898378 CTCCCAGTTAGGCTACACGGGGG + Intronic
997245924 5:132349201-132349223 CTCCCAGTTAGGCTACATGGGGG + Intergenic
997496983 5:134336760-134336782 CGCCCAGTCAGGCTACATGGGGG + Intronic
998626546 5:143852778-143852800 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
999049037 5:148502216-148502238 CTCCCAGTTAGGCTACTTGGGGG - Intronic
999358876 5:150964831-150964853 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
999394457 5:151218303-151218325 CTGCCAGTCCTGCTGCAGTGGGG + Intronic
999867719 5:155719360-155719382 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1000145132 5:158446641-158446663 CTCCCAGTCAGGCTACACCGGGG + Intergenic
1000214341 5:159140234-159140256 CTCCCAGTTAGGCTACATGGGGG - Intergenic
1000738384 5:164933886-164933908 CTCCCAGTCAGGATACATGGGGG + Intergenic
1000831166 5:166102834-166102856 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1001212220 5:169820339-169820361 CTCCCAGTTAGGCTACTTGGGGG - Intronic
1002229822 5:177754555-177754577 CTCCCAGTTAGGCTACTTGGGGG - Intronic
1002265523 5:178029222-178029244 CTCCCAGTTAGGCTACTTGGGGG + Intronic
1002673057 5:180885840-180885862 CTCCCAGTCAGGCTACACGGGGG + Intergenic
1002734742 5:181377018-181377040 CTCCCAGTCAGGATACACGGGGG + Intergenic
1002749786 6:97102-97124 CTCCCAGTCAGGATACACGGGGG - Intergenic
1002928301 6:1617680-1617702 CTGCCTGTCCGGCTGCAGTGTGG - Intergenic
1002996182 6:2287211-2287233 CTTCCAGTCAGGAGACATGGGGG - Intergenic
1003316750 6:5019984-5020006 CTCCCAGTCAGGCTACACGAGGG + Intergenic
1003647549 6:7926391-7926413 CTCCCAGTTAGGCTACACGGGGG - Intronic
1003987600 6:11452494-11452516 CTCCCAGTTAAGCTACATGGGGG - Intergenic
1004265094 6:14142343-14142365 CAGCCAGGCCGGCTGCCTGGAGG + Intergenic
1005305747 6:24512810-24512832 CTGCAATTCCAGCTACTTGGAGG - Intronic
1005373542 6:25158889-25158911 CTGCCAGTTAGGCTACTCGGGGG - Intergenic
1005788745 6:29274150-29274172 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1005936026 6:30521511-30521533 CTCCCAGTCAGGGTACACGGGGG - Intergenic
1006601236 6:35227662-35227684 CTGCAAGTCTGGCTACACAGGGG + Exonic
1007860258 6:44900741-44900763 CTCCCAGTTAGGCTACTTGGGGG - Intronic
1008529968 6:52447994-52448016 CTCCCAGTTAGGCTACTTGGGGG + Intronic
1008633219 6:53383417-53383439 CTCCAAGTTAGGCTACATGGGGG - Intergenic
1008798813 6:55341242-55341264 CTCCCAGTTAGGCTACTTGGGGG - Intronic
1008865488 6:56204666-56204688 CTCCCAGTCAGGATACACGGGGG - Intronic
1008963283 6:57288507-57288529 CTCCCAGTCAGGCTACACGGGGG - Intergenic
1008978570 6:57457210-57457232 CTCCCAGTGAGGCTACTTGGGGG + Intronic
1008993965 6:57636941-57636963 CTCCCAGTCAGGAGACATGGTGG - Intronic
1008999908 6:57701118-57701140 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1009166710 6:60350169-60350191 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1009182568 6:60536031-60536053 CTCCCAGTCAGGAGACATGGTGG - Intergenic
1009282480 6:61769905-61769927 CTCCCAGTTAGGCTACTTGGGGG - Intronic
1009290163 6:61870560-61870582 CTCCTAGTCAGGATACATGGGGG - Intronic
1009322808 6:62312736-62312758 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1009503661 6:64448575-64448597 CTCCCAGTTAGGCTACTTGGGGG - Intronic
1009519068 6:64658776-64658798 CTCCCAGTTAGGCTACTTGGGGG + Intronic
1009628716 6:66167186-66167208 CTCCCAGTTAGGCTACACGGGGG - Intergenic
1009988077 6:70805938-70805960 CTCCCAGTTAGGCTACACGGGGG + Intronic
1010003921 6:70974837-70974859 CTCCCAGTTAGGCTACACGGGGG - Intergenic
1010006301 6:70998701-70998723 CTCCCAGTCAGGATACACGGGGG - Intergenic
1010171769 6:72984141-72984163 CTCCCAGTTAGGCTACATGGGGG + Intronic
1010364291 6:75031536-75031558 CTCCCAGTTAGGCTAAATGGGGG - Intergenic
1010461373 6:76118188-76118210 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1010463756 6:76143147-76143169 CTCCCAGTTAGGCTACTTGGAGG + Intergenic
1010484333 6:76391227-76391249 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1010521994 6:76849409-76849431 CTCCCAGTCAGGATACACGGGGG + Intergenic
1010603712 6:77862794-77862816 CTCCCAGTTAGGCTACTTGGGGG - Intronic
1010667130 6:78643898-78643920 CTCCCAGTCAGGCTACGTGGGGG + Intergenic
1010667506 6:78647447-78647469 CTCCCAGTTAGGCTACATCGGGG - Intergenic
1010681734 6:78807093-78807115 CTCCCAGTCAGGATAAATGGGGG + Intergenic
1010822611 6:80433116-80433138 CTCCCAGTCAGGATACAAGGAGG + Intergenic
1010961563 6:82151606-82151628 CTCCCAGTTAGGCTACAGGGGGG - Intergenic
1010973070 6:82283814-82283836 CTCCCAGTCAGGATACATGGGGG + Intergenic
1010993084 6:82501859-82501881 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1010997618 6:82551435-82551457 CTCCCAGTTAGGCTACAGGGGGG + Intergenic
1011012313 6:82715920-82715942 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1011062943 6:83292554-83292576 CTCCCAGTCAGGCTACACAGGGG + Intronic
1011234655 6:85202698-85202720 CTCCCAGTCAGGCTACACGGGGG - Intergenic
1011245127 6:85314420-85314442 CTCCCAGTTAGGCTACACGGGGG + Intergenic
1011304158 6:85908458-85908480 CTCCCAGTTAGGCTACACGGGGG + Intergenic
1011338116 6:86283556-86283578 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1011848042 6:91590651-91590673 CTCCCAGTTAGGCTACACGGGGG - Intergenic
1012209239 6:96499736-96499758 CTCCCAGTTAGGCTACACGGGGG + Intergenic
1012590025 6:100969386-100969408 CTCCCAGTTAGGCTACACGGGGG - Intergenic
1012598034 6:101062700-101062722 CTCCCAGTCAGGCTACATGGGGG - Intergenic
1012725813 6:102808868-102808890 CTCCCAGTTAGGCTACACGGGGG + Intergenic
1012778073 6:103522581-103522603 CTCCCAGTCAGGATACATGGGGG - Intergenic
1012799093 6:103802540-103802562 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1013124465 6:107169900-107169922 CTCCCAGTTAGGCTACTTGGGGG + Intronic
1013267488 6:108513832-108513854 CTCCCAGTTAGGCTACTTGGGGG - Intronic
1013359571 6:109382056-109382078 CGGCGACTCCGGCAACATGGCGG - Intronic
1013383745 6:109603494-109603516 CTCCCAGTTAGGCTACTTGGGGG + Intronic
1013390314 6:109679640-109679662 CTCCCAGTCAGGAGACATGGGGG - Intronic
1013578265 6:111507154-111507176 CTCCCAGTTAGGCTACATGGGGG + Intergenic
1014013344 6:116501578-116501600 CTCCCAGTCAGGCTACATGGGGG - Intronic
1014184712 6:118421734-118421756 CTCCCAGTCAGGCTACACTGGGG - Intergenic
1014907160 6:127043935-127043957 CTCCTAGTTAGGCTACATGGGGG - Intergenic
1014938647 6:127413028-127413050 CTCCCATTTAGGCTACATGGGGG + Intergenic
1015133074 6:129836124-129836146 TTCCCAGTCAGGCTACACGGGGG - Intronic
1015290310 6:131531616-131531638 CTCCCAGTTAGGCTATATGGGGG + Intergenic
1016005962 6:139089856-139089878 CTCCCAGTTAGGCTACATGGGGG + Intergenic
1016265952 6:142232859-142232881 TTCCCAGTCAGGCTACACGGGGG - Intergenic
1016338488 6:143034836-143034858 CTCCCAGGCAGGCTACATGAGGG + Intergenic
1016436827 6:144046621-144046643 CTCCCAGTTAGGCTACACGGGGG + Intronic
1016691469 6:146943062-146943084 CTCCCAGTCAGGATACATGGGGG + Intergenic
1016717582 6:147251776-147251798 CTCCCAGTAAGGATACATGGGGG - Intronic
1017231629 6:152079195-152079217 CTCCCAGTCAGGCTACATGGGGG - Intronic
1017279681 6:152609684-152609706 ATCCCAGTTAGGCTACATGGGGG - Intronic
1017653596 6:156605402-156605424 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1017836472 6:158183313-158183335 CTCCCAGTCAGGCTACATGGGGG + Intronic
1018075987 6:160214176-160214198 CTCCCAGTTAGGCTACATGGGGG + Intronic
1018783034 6:167086357-167086379 CTCCCAGTCAGGCTACTTGGGGG + Intergenic
1019239000 6:170649338-170649360 CTCCCAGTCAGGATACACGGGGG + Intergenic
1020333477 7:7042821-7042843 CTCCCAGTCAGGATACATGGGGG - Intergenic
1020443134 7:8240105-8240127 CTCCCAGTTAGGCTACATGGGGG - Intronic
1020609128 7:10373241-10373263 CTCTCAGTTAGGCTACATGGGGG - Intergenic
1020640476 7:10747772-10747794 CTTCCAGTTAGGCTACTTGGGGG - Intergenic
1020659459 7:10965501-10965523 CTCCCAGTCAGGCTACTGGGGGG + Intergenic
1020774096 7:12431781-12431803 CTCCCAGTTAGGCTACATGGGGG + Intergenic
1020810035 7:12840215-12840237 CTCCCAGTCATTCTACATGGGGG - Intergenic
1020874616 7:13677592-13677614 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1021224504 7:18012359-18012381 CTCCCAGTCAGTATACATGGGGG + Intergenic
1021238690 7:18174887-18174909 CTCCCAGTTAGGCTACATGGCGG + Intronic
1021487348 7:21182070-21182092 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1021759719 7:23891904-23891926 CTGCCAGTACGGGCACAGGGTGG - Intergenic
1022867038 7:34432015-34432037 CTCCCAGTTAGGCTACACGGGGG - Intergenic
1022869189 7:34457902-34457924 CTTCCAGTCAGGATACACGGGGG - Intergenic
1023568904 7:41552578-41552600 CTCCCAGTTAGGCTACATGGGGG + Intergenic
1023651149 7:42370873-42370895 CTCCCAGTCAGGCTACATGTGGG + Intergenic
1023850573 7:44147804-44147826 CTGCAATGCCTGCTACATGGAGG - Exonic
1024106110 7:46088365-46088387 TTCCCAGTCAGGCTACGTGGGGG + Intergenic
1025122100 7:56313966-56313988 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1025593901 7:62900563-62900585 CTTCCAGTTAGGCTACTTGGGGG - Intergenic
1025787949 7:64660592-64660614 CTCCCAGTCAGGATACATGGGGG - Intergenic
1027378460 7:77578043-77578065 GTGCCAGGCTGGCTACATGCAGG - Intronic
1027449736 7:78317674-78317696 CTCCCAGTCAGGATACACGGGGG - Intronic
1027574553 7:79915760-79915782 CTCCCAGTTAGGCTACATGGGGG - Intergenic
1027637148 7:80689691-80689713 GTCCCAGTCAGGATACATGGAGG - Intergenic
1027701836 7:81479168-81479190 CTCCCAGTCAGGCTACACGGGGG - Intergenic
1027727800 7:81829464-81829486 CTGCCAGTTAGGCTACATGGGGG + Intergenic
1027790460 7:82634065-82634087 CTCCCAGTCAGGATACATGGGGG - Intergenic
1027792411 7:82650558-82650580 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1028004293 7:85542599-85542621 CTCCCAGTTAGGCTACACGGGGG + Intergenic
1028080369 7:86567863-86567885 CTCCTAGTCAGGCTACACGGGGG - Intergenic
1028114536 7:86982373-86982395 CTCCCAGTAAGGCTACACGGAGG - Intronic
1028139994 7:87263277-87263299 CTCCCAGTCAGGCTACATGCGGG + Intergenic
1028236895 7:88373325-88373347 CTCCCAGTCAGGCTACATGGGGG + Intergenic
1028340991 7:89719410-89719432 CTCCCAGTCAGGCTACACAGGGG - Intergenic
1028412973 7:90550952-90550974 CTCCCTGTCAGGCTACATGGGGG + Intronic
1028458214 7:91061822-91061844 CTCCCAGTTAGGCTACTTGGGGG + Intronic
1028526367 7:91791162-91791184 CTCCCAGTTAGGCTACAGGGGGG - Intronic
1028578525 7:92380446-92380468 CTCCAAGTTAGGCTACATGGGGG - Intronic
1028652780 7:93169864-93169886 CTCCCAGTCAGGATACACGGGGG + Intergenic
1028692007 7:93663473-93663495 CTCCAAGTTAGGCTACATGGGGG + Intronic
1029059882 7:97786310-97786332 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1029313851 7:99693328-99693350 TTCCCAGTCAGGCTACAGGGGGG + Intronic
1029810105 7:103038525-103038547 TTCCCAGTCAGGCTACATGGGGG - Intronic
1029850514 7:103456959-103456981 CTCCCAGTTAGGGTACATGGGGG + Intergenic
1030177784 7:106672446-106672468 CTCCCAGTTAGGCTACATAGGGG - Intergenic
1030179381 7:106689792-106689814 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1030202517 7:106919499-106919521 TTCCCAGTCAGGCTACATGGGGG - Intergenic
1030451639 7:109719826-109719848 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1030457819 7:109795687-109795709 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1030817563 7:114055637-114055659 CTCCCAGTTAGGCTACTTGGGGG - Intronic
1031284956 7:119855515-119855537 CTCCCAGTTCGGCTACTCGGGGG - Intergenic
1031314562 7:120240253-120240275 CTCCCAGTTCGGCTACTCGGGGG + Intergenic
1031434231 7:121712898-121712920 CTCCCAGTTAGGCTACATGGGGG + Intergenic
1031591216 7:123594716-123594738 CTCCCTGTCAGGCTACACGGGGG + Intronic
1031829947 7:126614096-126614118 CTCCCAGTTAGGCTACTTGGAGG - Intronic
1032250646 7:130254475-130254497 CTCCCAGTTAGGCTACACGGGGG + Intergenic
1032312517 7:130801982-130802004 CTCCCAGTCAGGAGACATGGGGG + Intergenic
1032445926 7:131983759-131983781 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1033863440 7:145659263-145659285 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1033887582 7:145967268-145967290 CTCCAAGTTAGGCTACATGGGGG - Intergenic
1034583290 7:152065863-152065885 CTCCCAGTTAGGCTACTTGGGGG + Intronic
1034689082 7:152999682-152999704 CTCCCAGTCAAGATACATGGGGG + Intergenic
1035508770 8:157271-157293 CTCCCAGTCAGGATACACGGGGG - Intergenic
1035675185 8:1451163-1451185 CTGCCAGTGCTGCTGCATGCAGG + Intergenic
1037050092 8:14362117-14362139 CTCCCAGTCAGGCTACACGTGGG + Intronic
1037557595 8:20040748-20040770 CTCCCAGTTAGGCTACATGGGGG + Intergenic
1038083242 8:24163976-24163998 CTCCCAGTCAGGAGACATGGGGG + Intergenic
1039146302 8:34451161-34451183 CTCCAAGTTAGGCTACATGGGGG + Intergenic
1039347748 8:36726449-36726471 TTCACAGTCAGGCTACATGGGGG - Intergenic
1039634011 8:39143643-39143665 TTCCCAGTCAGGCTACATGGGGG + Intronic
1039832420 8:41225682-41225704 CTCCCAGTTAGGCTACACGGAGG - Intergenic
1040410944 8:47153470-47153492 CTCCCAGTTTGGCCACATGGGGG - Intergenic
1040556743 8:48486250-48486272 CTCCCAGTTAGGCTACATGGGGG - Intergenic
1040749877 8:50692672-50692694 CTCCCAGTTAGGCTACTTGGGGG + Intronic
1040779969 8:51095655-51095677 CTCCCAGTCAGGATACACGGGGG - Intergenic
1040942978 8:52852126-52852148 CTCCTAGTCAGGATACATGGGGG + Intergenic
1041155956 8:54986684-54986706 CTCCCAGTTAGGCTACATGGGGG - Intergenic
1041295826 8:56356624-56356646 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1041423618 8:57695862-57695884 CTCCCAGTCAGGATACATGGGGG - Intergenic
1041909907 8:63077873-63077895 CTCCCAGTTAGGCTATATGGGGG - Intronic
1041997752 8:64084364-64084386 CTCCCAGTTAGGCTACCTGGGGG - Intergenic
1042070741 8:64930874-64930896 CTCCCAGTTAGGATACATGGGGG + Intergenic
1042072918 8:64956268-64956290 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1042195648 8:66229218-66229240 CTCCCAGTCAGGAAACATGGGGG - Intergenic
1042349418 8:67761802-67761824 CTCCCAGTCAGGATACACGGGGG - Intergenic
1042541136 8:69907943-69907965 CTCCCAGTTAGGCTACACGGGGG - Intergenic
1042597467 8:70465444-70465466 CTCCCAGTCAGGCTACACGGCGG + Intergenic
1042614210 8:70631319-70631341 CTCCCAGTTAGGCTACATGGGGG + Intronic
1043129354 8:76441845-76441867 CTCCCAGTCAGGCTACAATGGGG + Intergenic
1043165800 8:76901530-76901552 CTCCCAGTTAGGCTACATGGGGG + Intergenic
1043279475 8:78445557-78445579 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1043535964 8:81204846-81204868 CTCCCAGTTAGGCTACTTGGTGG + Intergenic
1043747838 8:83898465-83898487 CTCCCAGTTAGGCTACTTGGTGG - Intergenic
1043748799 8:83909344-83909366 CTCCCAGTCAGTATACATGGGGG - Intergenic
1043818997 8:84839687-84839709 CTCCCAGTTAGGCTACTTGGGGG - Intronic
1043844628 8:85150393-85150415 TTCCCAGTCAGGCTACACGGGGG - Intergenic
1043938821 8:86173815-86173837 CTCCCAGTTAGGCTACACGGGGG + Intergenic
1044073801 8:87793826-87793848 CTCCCAGTTAGGCTACGTGGGGG - Intergenic
1044134973 8:88574791-88574813 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1044449128 8:92313587-92313609 CTCCCAGTTAGGTTACATGGAGG + Intergenic
1044521556 8:93205157-93205179 CTGCTAGTTAGGCTACATGGAGG + Intergenic
1044596978 8:93969263-93969285 CTCCCAGTTAGGCTACATGGGGG + Intergenic
1044601405 8:94009044-94009066 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1044615577 8:94137073-94137095 CTCCCAATTAGGCTACATGGGGG + Intronic
1044767613 8:95593480-95593502 CTCCCAGTTAGGCTACATGGGGG + Intergenic
1044809022 8:96038545-96038567 CTCCCAGTTAGGCTACATGGGGG + Intergenic
1044956569 8:97487583-97487605 CTCCCAGTTGGGCTACTTGGGGG + Intergenic
1045088253 8:98710858-98710880 CTCCCAGTTAGGCTACTTGGGGG - Intronic
1045201796 8:99990819-99990841 CTCCCAGTTAGGCTACATGGGGG - Intronic
1045618974 8:103952295-103952317 CTCCTAGTCAGGATACATGGGGG - Intronic
1045779388 8:105846084-105846106 CTCCCAGTCAGGCTACACAGGGG + Intergenic
1045797766 8:106065757-106065779 CTCCCAGTCAGGATACATGGGGG - Intergenic
1045928318 8:107596709-107596731 CTCCCAGTGAGGCTACTTGGGGG + Intergenic
1045933468 8:107653663-107653685 CTCCCAGTCAGGCTACACGGGGG + Intergenic
1047129406 8:122001936-122001958 CTCCCAGTTAGGCTACATGGGGG - Intergenic
1047931597 8:129733375-129733397 CTCCCAGTTAGGCTACATGGGGG - Intergenic
1048280090 8:133099188-133099210 CTGCTAGCCCTGCTCCATGGCGG + Intronic
1048521209 8:135157068-135157090 CTCCCAGTTAGGCTACACGGGGG + Intergenic
1050034810 9:1424167-1424189 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1050320750 9:4449533-4449555 CTCCCAGTTAGGCTACACGGGGG - Intergenic
1050509288 9:6376975-6376997 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1050597359 9:7216967-7216989 CTCCCAATCAGGCTACATAGGGG - Intergenic
1050645360 9:7713612-7713634 CTCCCAGTTAGGCTACACGGGGG - Intergenic
1050700125 9:8329469-8329491 CACCCAGTCAGGATACATGGGGG + Intronic
1050852123 9:10300951-10300973 CTTCCAGTCAGGATACATGGGGG - Intronic
1051308875 9:15747436-15747458 CTCCCAGTCAGGCTACACGAGGG - Intronic
1051614887 9:18997676-18997698 CTCCCAGTCAGGCTACATGGGGG - Intronic
1051670402 9:19504526-19504548 CTCCCAGTCAGGATACATGGGGG + Intergenic
1052134150 9:24889465-24889487 CTCCCAGTCAGGATACATGGGGG - Intergenic
1052329456 9:27252172-27252194 CTCCCAGTCAGGATACATGGGGG - Intergenic
1052746603 9:32447998-32448020 CTTCCAGTCAGGATACATGGGGG + Intronic
1052770542 9:32684825-32684847 CTCCCAGTTAGGCTACATGGGGG - Intergenic
1052992873 9:34531982-34532004 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1054887213 9:70212050-70212072 CTCCCAGTTAGGCTACTTGGGGG + Intronic
1054890040 9:70240991-70241013 TTCCCAGTTAGGCTACATGGGGG - Intergenic
1054997398 9:71407790-71407812 CTCCCAGTCAGGCTACTTGTGGG - Intronic
1055614297 9:78054909-78054931 TTCCCAGTCAGGCTACATGGGGG - Intergenic
1056016289 9:82391619-82391641 CTCCCAGTTAGGCTACACGGGGG + Intergenic
1056348415 9:85723107-85723129 CTCCCAGTCAGGCTACATGGGGG + Intronic
1056829815 9:89906773-89906795 CTCCCAGTTAGGCTACATGGGGG - Intergenic
1056997095 9:91473140-91473162 CTCCCAGTTAGGCTACACGGGGG + Intergenic
1058012048 9:99989246-99989268 CTCCCAGTTAGGCTACACGGGGG - Intronic
1058074566 9:100637704-100637726 CTCCCAGTCAGGCTACACGGGGG + Intergenic
1058081910 9:100709887-100709909 CTCCCAGTCAGGCTACACAGGGG + Intergenic
1058393257 9:104520860-104520882 CTCCCAATCAGGATACATGGGGG - Intergenic
1058558980 9:106203685-106203707 CTCCCAGTCAGGCTACACAGGGG + Intergenic
1058819297 9:108714166-108714188 CTCCCAGTTAGGCTACACGGGGG - Intergenic
1058926078 9:109665622-109665644 CTCCCAGTTAGGCTACGTGGCGG + Intronic
1059513423 9:114870394-114870416 CTCCCAGTCAGGATACATGGGGG - Intergenic
1060133902 9:121133071-121133093 CTCCCAGTTAGGCTACACGGGGG + Intronic
1060326221 9:122618445-122618467 CTCCCAGTCAGGCTACACGGAGG + Intergenic
1061046874 9:128170055-128170077 CTGCCAGCTCTACTACATGGGGG - Exonic
1062759205 9:138329628-138329650 CTCCCAGTCAGGATACACGGGGG + Intergenic
1203599655 Un_KI270748v1:401-423 CTCCCAGTCAGGATACACGGGGG + Intergenic
1185806271 X:3060001-3060023 CTCCCAGTTAGGCTACAAGGGGG - Intronic
1186354278 X:8773626-8773648 CTCCCAGTCAGGATACATGGGGG - Intergenic
1186563612 X:10638724-10638746 CTCCCAGTTAGGCTACTTGGGGG - Intronic
1186571116 X:10715764-10715786 CTCCCAGTTAGGCTACTTGGGGG - Intronic
1186743120 X:12538544-12538566 CTCCCAGTTAGGCTACTTGGGGG - Intronic
1187295183 X:17992536-17992558 TTGCCTGTCCGGCTACAGGAGGG + Intergenic
1187453266 X:19417761-19417783 CTCCCAGTTAGGCTACTTGGGGG - Intronic
1187728996 X:22234245-22234267 CTCCCAGTCAGGATACACGGGGG + Intronic
1188044789 X:25413480-25413502 CTCCCAGTTAGGCTACACGGGGG + Intergenic
1188084196 X:25883024-25883046 CTCCCAGTCAGGATACATGGGGG - Intergenic
1188108955 X:26175163-26175185 CTCCCAGTTAGGCTACGTGGGGG - Intergenic
1188119475 X:26286757-26286779 CTCCCAGTTAGGCTACACGGGGG + Intergenic
1188123156 X:26334693-26334715 CTCCCAGTTAGGTTACATGGGGG - Intergenic
1188944195 X:36278020-36278042 CTCCCAGTTAGGCTACACGGGGG + Intronic
1188954527 X:36418297-36418319 CTCCCAGTTAGGCTACACGGGGG + Intergenic
1189017635 X:37301008-37301030 CTCCCAGTTAGGCTACATGGGGG + Intergenic
1189524890 X:41809308-41809330 CTCCCAGTTAGGCTACTTGGGGG - Intronic
1189575032 X:42342825-42342847 CTCCCAGTCAGGATACACGGGGG + Intergenic
1189702547 X:43727129-43727151 CTCTCAGTCAGGCTACACGGGGG + Intronic
1189939297 X:46104565-46104587 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1189978409 X:46485801-46485823 CTCCCAGTCAGGCTACACGAGGG + Intronic
1190603047 X:52111830-52111852 CTGCCAGTTAGGCTACTCGGGGG - Intergenic
1190649086 X:52551439-52551461 TTCCCAGTCAGGCTACATGATGG - Intergenic
1191002319 X:55673790-55673812 CTCCCAGTGAGGCTACATGGGGG + Intergenic
1191012391 X:55774335-55774357 CTCCCAGTTAGGCTACATGAGGG + Intergenic
1191016045 X:55811470-55811492 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1191080928 X:56508640-56508662 CTCACAGTCAGGATACATGGGGG - Intergenic
1191096130 X:56674376-56674398 CTCCCAGTCAGGCTACATGGGGG - Intergenic
1191134555 X:57049621-57049643 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1191138977 X:57095330-57095352 CTCCGAGTCAGGATACATGGGGG - Intergenic
1191170656 X:57444033-57444055 CTCCCAGTTAGGCTACCTGGGGG + Intronic
1191181215 X:57565627-57565649 TTCCCAGTCCAGCTACATGGGGG - Intergenic
1191197956 X:57744805-57744827 CTCCCAGTCAGGCTAAAAGGGGG - Intergenic
1191643303 X:63451782-63451804 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1191683510 X:63865757-63865779 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1191745625 X:64483791-64483813 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1191772388 X:64775148-64775170 CTCCCAGTTAGGCTACACGGGGG - Intergenic
1191795725 X:65019220-65019242 CTCCCAGTCAGGATACATGGGGG - Intronic
1191827315 X:65379304-65379326 CTCCCAGTTAGGCTGCATGGGGG - Intronic
1191835006 X:65454697-65454719 CTCCCAGTTAGGCTACTTGGGGG - Intronic
1191871695 X:65751660-65751682 CTGCCAATCATGCTACATGTAGG - Intergenic
1191882376 X:65856096-65856118 CTCCAAGTTAGGCTACATGGCGG + Intergenic
1191886510 X:65894091-65894113 CTCCCAGTCAGGCTACACAGGGG + Intergenic
1191907345 X:66107735-66107757 CTCCCAGTTAGGCTACACGGGGG + Intergenic
1191935513 X:66423423-66423445 CTTCCAGTTAGGCTACTTGGGGG + Intergenic
1191969135 X:66794458-66794480 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1191990215 X:67026886-67026908 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1192101100 X:68265248-68265270 CTCCCAGTTAGGCTACTTGGGGG - Intronic
1192243257 X:69351462-69351484 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1192385258 X:70661594-70661616 CTCCCAGTTAGGCTACTTGGGGG - Intronic
1192401375 X:70839210-70839232 CTCCCAGTTAGGCTACTTGGGGG - Intronic
1192637116 X:72830582-72830604 CTCCCAGTCAGGATACATGGGGG + Intronic
1192644598 X:72890232-72890254 CTCCCAGTCAGGATACATGGGGG - Intronic
1192674649 X:73183072-73183094 CTCCCAGTCAGGTGACATGGAGG - Intergenic
1192761626 X:74100489-74100511 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1192825964 X:74696394-74696416 CTCCCAGTTAGGCTACACGGGGG - Intergenic
1192878658 X:75258805-75258827 CTCCCAGTCAGGATACATGGGGG - Intergenic
1192936351 X:75862671-75862693 CTCCCAGTTAGACTACATGGGGG + Intergenic
1192949095 X:75997556-75997578 CTCCCAGTCAAGCTACACGGGGG + Intergenic
1192964243 X:76160003-76160025 CTCCTAGTCAGGATACATGGGGG - Intergenic
1192993520 X:76487967-76487989 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1192997431 X:76527277-76527299 CTCCCAGTCAGGCTACACTGGGG + Intergenic
1193001605 X:76568739-76568761 TTCCCAGTCAGGTTACATGGGGG - Intergenic
1193035923 X:76951082-76951104 TTCCCAGTTAGGCTACATGGGGG - Intergenic
1193072376 X:77319586-77319608 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1193123383 X:77846855-77846877 CTCCCAGTTAGGCTACTTGGGGG + Intronic
1193161295 X:78232516-78232538 CTCCCAGTTAGGATACATGGTGG + Intergenic
1193338623 X:80319959-80319981 CTCCCAGTTAGGCTACACGGGGG - Intergenic
1193343720 X:80382419-80382441 CTCCCAGTTAGGCTACACGGGGG + Intronic
1193409393 X:81144185-81144207 CTTCCAGTCAGGATACACGGGGG - Intronic
1193419860 X:81270659-81270681 CTCCCAGTCAGGCTACACGGGGG + Intronic
1193477288 X:81982163-81982185 CTCCCAGTCAGGCTACAGTGGGG - Intergenic
1193542506 X:82788977-82788999 CTCCCAGTCAGGCTACACGTGGG - Intergenic
1193641017 X:84009511-84009533 CTCCCAGTTAGGCTACATGGGGG - Intergenic
1193806610 X:86002948-86002970 CTCCCAGTTAGGCTACACGGGGG - Intronic
1194677793 X:96814963-96814985 CTCCCAGTTAGGCTACACGGGGG + Intronic
1194726972 X:97410081-97410103 CTCCCAGTTAGGCTACACGGGGG - Intronic
1194944522 X:100051483-100051505 CTGCCGGTTAGGCTACACGGGGG - Intergenic
1195281575 X:103339753-103339775 CTGCCAGTCCATCTCCCTGGGGG - Intergenic
1195580214 X:106493273-106493295 CTCCCAGTCAGGATACATGGGGG + Intergenic
1195587184 X:106578564-106578586 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1195622094 X:106967017-106967039 CTCCCAGTCAGGCTACACGGGGG - Intronic
1195735911 X:108012116-108012138 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1195828086 X:109024759-109024781 TTCCCAGTCAGGCCACATGGAGG + Intergenic
1195847901 X:109248464-109248486 CTCCCAGTTAGGCTACATGGAGG + Intergenic
1195912258 X:109900902-109900924 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1195947455 X:110230217-110230239 CTCCCAGTTAGGCTACACGGGGG - Intronic
1195988391 X:110657591-110657613 TTCCCAGTCAGGCTACATGGGGG - Intergenic
1196159063 X:112462511-112462533 CTCCCAGTCAGGCTACATGGGGG - Intergenic
1196167422 X:112551189-112551211 CTCCCAGTCAGGCTACACGGGGG + Intergenic
1196230149 X:113211964-113211986 CTCCCAGTCAGGCTACATGGGGG + Intergenic
1196275938 X:113765188-113765210 CTGCCAGTGTGGCTACAAGCAGG + Intergenic
1196587274 X:117444126-117444148 CTGCCAGTCAGGATACACAGGGG - Intergenic
1197489824 X:127102922-127102944 CTCCCAGTTAGGCTACATGGGGG - Intergenic
1197543011 X:127789488-127789510 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1197959669 X:131990165-131990187 CTTCCAGTTAGGCTACATGGGGG - Intergenic
1198072226 X:133160039-133160061 CTCCCAGTCAGGATACATGGGGG - Intergenic
1198168420 X:134080166-134080188 CTTCCAGTTTGGCTACTTGGGGG - Intergenic
1198366057 X:135941189-135941211 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1198572403 X:137971678-137971700 CTCCCAGTCAGGCTACACAGGGG - Intergenic
1198663543 X:138996865-138996887 ATCCCAGTCAGGCTACATGTGGG - Intronic
1198725775 X:139675754-139675776 CTCCCAGTTAGGCTACACGGAGG + Intronic
1199181040 X:144854328-144854350 CTCCCAGTTAGGCTACACGGGGG - Intergenic
1199344218 X:146719749-146719771 CTCCCAGTTAGGCTACACGGGGG - Intergenic
1199383823 X:147200985-147201007 CTCCCAGTTAGGCTACATGGGGG - Intergenic
1200732519 Y:6758100-6758122 CTCCCAGTCAGAATACATGGGGG + Intergenic
1200810443 Y:7479260-7479282 CTCCCAGTTAGGCTACATGGGGG + Intergenic
1200839128 Y:7762253-7762275 CTCCCAGTCAGGCTAGATGGGGG - Intergenic
1200963169 Y:9013460-9013482 CTGCCATTGCACCTACATGGAGG + Intergenic
1201333439 Y:12852967-12852989 CTCCCAGTTAGGCTACCTGGCGG + Intronic
1201353504 Y:13072311-13072333 CTCCCAATTAGGCTACATGGGGG - Intergenic
1201393065 Y:13519728-13519750 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1201614891 Y:15886144-15886166 CTCCCAGTTAGGCTGCATGGGGG - Intergenic
1201670578 Y:16515876-16515898 CTCTCAGTCAGGCTACATGGGGG + Intergenic
1201684348 Y:16683910-16683932 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1201933342 Y:19378582-19378604 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1202022279 Y:20477863-20477885 CTCCCAGTTAGGCTACTTGGGGG - Intergenic
1202041969 Y:20695320-20695342 CTTCCAGTTAGGCTACATGAGGG + Intergenic
1202058150 Y:20857480-20857502 CTCCCAGTTAGGCTACTTGGGGG + Intergenic
1202356732 Y:24059330-24059352 CTCCCAGTTAGGCTACCTGGGGG - Intergenic
1202514046 Y:25610780-25610802 CTCCCAGTTAGGCTACCTGGGGG + Intergenic