ID: 978150668

View in Genome Browser
Species Human (GRCh38)
Location 4:105430608-105430630
Sequence GACACTCTGTTGCCTAGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 107}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978150668_978150672 17 Left 978150668 4:105430608-105430630 CCTGATCTAGGCAACAGAGTGTC 0: 1
1: 0
2: 2
3: 22
4: 107
Right 978150672 4:105430648-105430670 ATGATAAAAGGACAAGATAGAGG 0: 1
1: 0
2: 1
3: 24
4: 324
978150668_978150671 5 Left 978150668 4:105430608-105430630 CCTGATCTAGGCAACAGAGTGTC 0: 1
1: 0
2: 2
3: 22
4: 107
Right 978150671 4:105430636-105430658 AGGTTCTCTAATATGATAAAAGG 0: 1
1: 0
2: 2
3: 26
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978150668 Original CRISPR GACACTCTGTTGCCTAGATC AGG (reversed) Intronic
902794607 1:18793105-18793127 GGAGCTCTGTTGCCTAGATGCGG + Intergenic
904319777 1:29689391-29689413 GAGACTCTGTTGCTCAGAGCTGG + Intergenic
907321799 1:53607299-53607321 CTCACTCTGTTGCCTAGGCCAGG + Intronic
912387324 1:109278065-109278087 GACACTTTGGTGCCTAAGTCAGG + Intergenic
915536300 1:156537925-156537947 CTCACTCTGTTGCCTAGAGCTGG + Intronic
922700737 1:227758693-227758715 CACACCCTGCTGCCTTGATCTGG - Intronic
923402631 1:233629649-233629671 GGCACTCTGTTGCCTAACTCCGG - Intronic
1063904255 10:10766467-10766489 GACACACTGCTGCCTCCATCGGG + Intergenic
1064742216 10:18445425-18445447 GAAACTCTGTTGCCAAAATATGG - Intronic
1067961453 10:50856305-50856327 CACACTCTGTAGCCAAAATCAGG + Intronic
1068953476 10:62801670-62801692 CTCACTCTGTTGCCTAGGCCTGG + Intergenic
1072508157 10:96090661-96090683 GGCACTCTGTTGCCCAGAGAGGG + Intergenic
1074523285 10:114243903-114243925 CACACTCTGTTGAGGAGATCAGG + Intronic
1077609796 11:3637157-3637179 GTGAGTCTGTTGCCCAGATCTGG - Intergenic
1089734542 11:120540581-120540603 CTCACTCTGTTGCCTAGACTGGG - Intronic
1090430287 11:126640409-126640431 GACAGTCTGTTTGCTAGTTCCGG - Intronic
1092838539 12:12515804-12515826 CTCACTCTGTTGCCTACACCAGG + Intronic
1092997145 12:13961181-13961203 GCCACTCTGTTTCCTCGAACTGG - Intronic
1095430972 12:42134168-42134190 CTCACTCTGTTGCCCAGACCTGG - Intronic
1098127626 12:67316950-67316972 CTCACTATGTTGCCTAGAGCTGG - Exonic
1100478329 12:94954380-94954402 GACTCTGTGTTCCCTAGATAAGG + Intronic
1102654246 12:114467478-114467500 CTCACTCTGTTGCCCAGCTCTGG + Intergenic
1105937893 13:25118887-25118909 GACACTCTCTTACCGGGATCTGG - Intergenic
1106666571 13:31857389-31857411 AACACTCTGGTGCCAAGATTGGG + Intergenic
1118555704 14:67018447-67018469 GACAAGCTGTTGCCTTTATCTGG - Intronic
1119664074 14:76471994-76472016 GAAACTCAGTTGACCAGATCAGG - Intronic
1119989651 14:79181649-79181671 CACACTCTGTTGCCCAGGACTGG - Intronic
1122746436 14:103899756-103899778 GACACTCTGTTGTTGAGATTCGG - Intergenic
1127496566 15:59518352-59518374 CTCACTCTGTTGCCTAGGCCGGG + Intronic
1129388337 15:75207864-75207886 GACACCATGTTGCCCACATCTGG - Exonic
1131523937 15:93137731-93137753 CAAACTCTGTTGACTAGATTAGG - Intergenic
1132006840 15:98235045-98235067 GACACTCTGGTGGCTGGACCTGG + Intergenic
1132353145 15:101153026-101153048 GAGACGCCGTTGCCTAGAGCTGG - Intergenic
1132595574 16:747727-747749 TGCACTCTGTTGCCTGGCTCTGG - Intronic
1145210218 17:21007332-21007354 GACAGTCCTTTGCCTAGATCAGG + Intronic
1146407399 17:32550943-32550965 GACACTCTGTTGCCTAGGGCTGG - Intronic
1146552877 17:33797159-33797181 GAAATTCTGCTGCATAGATCAGG + Intronic
1146857590 17:36266586-36266608 CTCACTCTGTTGCCTAGGCCAGG + Intronic
1147076383 17:37991120-37991142 CTCACTCTGTTGCCTAGGCCAGG + Intronic
1147077420 17:38001939-38001961 CTCACTCTGTTGCCTAGGCCAGG - Intronic
1147087908 17:38070665-38070687 CTCACTCTGTTGCCTAGGCCAGG + Intergenic
1147109302 17:38249848-38249870 CTCACTCTGTTGCCTAGGCCAGG - Intergenic
1147470323 17:40652591-40652613 CTCACTCTGTTGCCTAAAGCTGG + Intergenic
1148420148 17:47538236-47538258 CTCACTCTGTTGCCTAGGCCAGG + Intronic
1151012564 17:70517285-70517307 CACACTCTGTTGCTTTGTTCCGG + Intergenic
1203171655 17_GL000205v2_random:153972-153994 GAAATTCTGTTTCCTAGATCAGG + Intergenic
1203174087 17_GL000205v2_random:178827-178849 GAAATTCTGTTTCCTAGATCAGG - Intergenic
1152995027 18:398584-398606 GACAGTCAGTTGCCTGCATCAGG - Intronic
1155471507 18:26196809-26196831 GTCTCTCTGTTGCCCAGAACTGG - Intergenic
1155998263 18:32355962-32355984 CACATTCTATTGCCTAAATCAGG + Intronic
1158503224 18:58022321-58022343 GACACTCTGTTGTATAGACTCGG + Intergenic
1161955846 19:7494558-7494580 GTATCTCTGTTGCCTAGAGCGGG - Intronic
1167328693 19:48840769-48840791 GACACTCTGATGTTCAGATCTGG + Intronic
1168357581 19:55712065-55712087 GACGCTCTGCTGTCTAGACCCGG + Intronic
926224422 2:10956784-10956806 GTCACTCTTGTGCCCAGATCTGG - Intergenic
930979004 2:57498756-57498778 GAGACTCTGTTTCCTAGAACTGG + Intergenic
932467930 2:71935294-71935316 GAGTCTCTGCTGCCCAGATCAGG - Intergenic
933247264 2:79989608-79989630 CTCACTCTGTTGCCCAGACCAGG - Intronic
937397904 2:121554709-121554731 GACACACCATTGCCTAGAGCTGG + Intronic
940326579 2:152431932-152431954 TTCACTCTGTTGCCCAGACCAGG - Intronic
943770901 2:191715536-191715558 GAAACTCTTTTGCCTATAGCTGG - Intergenic
946938454 2:224746182-224746204 TAGACTCTGTTCCCTAGTTCAGG + Intergenic
1170842980 20:19939071-19939093 CTCGCTCTGTTGCCTAGAGCTGG + Intronic
1173645975 20:44633377-44633399 GACTCTCTGTTTCCTAGGTCTGG + Intronic
1176327637 21:5515807-5515829 GAAATTCTGTTTCCTAGATCAGG + Intergenic
1176330079 21:5540469-5540491 GAAATTCTGTTTCCTAGATCAGG - Intergenic
1176397678 21:6280482-6280504 GAAATTCTGTTTCCTAGATCAGG + Intergenic
1176400120 21:6305144-6305166 GAAATTCTGTTTCCTAGATCAGG - Intergenic
1176437037 21:6683960-6683982 GAAATTCTGTTTCCTAGATCAGG + Intergenic
1176439479 21:6708622-6708644 GAAATTCTGTTTCCTAGATCAGG - Intergenic
1176461299 21:7011030-7011052 GAAATTCTGTTTCCTAGATCAGG + Intergenic
1176463741 21:7035691-7035713 GAAATTCTGTTTCCTAGATCAGG - Intergenic
1176484860 21:7392808-7392830 GAAATTCTGTTTCCTAGATCAGG + Intergenic
1176487302 21:7417470-7417492 GAAATTCTGTTTCCTAGATCAGG - Intergenic
1178431928 21:32525159-32525181 GTCACTCTGTTGCCTAGGCTGGG - Intergenic
1179034287 21:37746325-37746347 GTTACTCTGTTCCCCAGATCTGG - Intronic
1180117875 21:45724074-45724096 GACACTCTCTCCCCCAGATCTGG + Intronic
1180258577 21:46650924-46650946 GACACACAGTTCCCTACATCTGG - Intronic
1182974626 22:34611380-34611402 GTCACTTTGTTGCCCAGAGCTGG - Intergenic
1182980412 22:34665531-34665553 GACACTCTTTTTCCAAGTTCTGG - Intergenic
1183875892 22:40781139-40781161 CTCACTCTGTTGCCCAGCTCTGG - Intronic
1184117123 22:42428687-42428709 GTCCCTCTGGTGCCTAGAACCGG + Intronic
1185069229 22:48647182-48647204 GACACTCTCATGCCTAGACTCGG + Intronic
953871333 3:46629859-46629881 GAGTCGCTGTTGCATAGATCTGG + Intergenic
954225205 3:49176808-49176830 GACACTCTGTAACTTGGATCTGG - Intergenic
954735004 3:52699991-52700013 GACACTCTAGTGACTAGAGCAGG + Intronic
960745774 3:120886811-120886833 CTCACTCTGTTGCCCAGAGCTGG + Intergenic
973610438 4:52631575-52631597 GACACACTGTTCTCTAGGTCTGG + Intronic
976117505 4:81743834-81743856 GAGACTCTGTTGCCAAGAACTGG - Intronic
978150668 4:105430608-105430630 GACACTCTGTTGCCTAGATCAGG - Intronic
981085926 4:140683514-140683536 GAGAAGCTGTTGCCTAGAACTGG - Intronic
988273758 5:29053627-29053649 GAAACTCTGTTGGCAAGATTAGG + Intergenic
988484505 5:31657487-31657509 GTCACTGTGTTTCCCAGATCTGG - Intronic
993221663 5:85106355-85106377 GAATCTATGTTGCCTAGATAGGG - Intergenic
996885277 5:128346636-128346658 CTCACTCTGTTGCCCAGACCAGG + Intronic
1000261226 5:159590622-159590644 GTCACTCTGCTGCCTTGATTTGG + Intergenic
1002297136 5:178238001-178238023 GACACTCTGCTCCCTGGAGCTGG + Exonic
1008965039 6:57306569-57306591 GACACTCCTGTGCATAGATCTGG - Intergenic
1011414427 6:87102743-87102765 CTCACTCTGTTGCCCAGAGCTGG + Intergenic
1012025115 6:93979833-93979855 GAATCTCTGTTGCCCAGAGCAGG - Intergenic
1017164457 6:151394116-151394138 GAGACTCTGTTGCCCAGACTAGG - Intergenic
1019743217 7:2685527-2685549 CTCACTCTGTTGCCCAGAGCTGG - Intronic
1019792582 7:3026532-3026554 CTCACTCTGTTGCCCAGGTCAGG + Intronic
1020956689 7:14747581-14747603 GAAACTCTGATGCCTAAATTTGG - Intronic
1021891038 7:25186579-25186601 GACAGTCTTTTGCCTAGATCGGG - Intergenic
1025707847 7:63883603-63883625 GAAATTCTGTTCCCCAGATCAGG + Intergenic
1026930579 7:74220970-74220992 GACACTCTGTGTCCCAGAGCAGG - Intronic
1033383980 7:140853339-140853361 TTCACTCTGTTGCCTAGGTTGGG - Intronic
1037348684 8:17925804-17925826 CACACTCTGTTGCCTAGGCTGGG - Intronic
1038652825 8:29421154-29421176 AACTCCCTGTTGCCTAAATCTGG - Intergenic
1040355754 8:46617097-46617119 GAGTCTCTGCTTCCTAGATCAGG + Intergenic
1040862467 8:52013719-52013741 GTCACTCTGTCGCCCAGACCTGG - Intergenic
1043525316 8:81090362-81090384 GACATTCTGTTACTTAGATGAGG + Intronic
1046765621 8:118066388-118066410 CTCACTCTGTTGCCCAGAGCTGG + Intronic
1047548541 8:125843899-125843921 GACTCTCTGGTGGATAGATCTGG - Intergenic
1049232574 8:141492203-141492225 GGCACTCTGTTACCTAGGTCAGG - Intergenic
1052742982 9:32411907-32411929 CTCACTCTGTTCCCTAGACCGGG + Intronic
1052803973 9:32996305-32996327 CTCACTCTGTTGCCCAGATTGGG + Intronic
1053364511 9:37512994-37513016 GACACTCTGTTGCCCAGGCTGGG + Intronic
1055334080 9:75214335-75214357 GACACTCTGATCCTCAGATCTGG + Intergenic
1059152675 9:111963513-111963535 GTCACTCTGTTGCCCAGACTGGG - Intergenic
1059919628 9:119144402-119144424 CTCACTCTGTTGCCCAGATTGGG + Intergenic
1060586889 9:124792257-124792279 GACACACTGGAGCCTAGATCAGG - Intronic
1060586895 9:124792293-124792315 GACACACAGGAGCCTAGATCAGG - Intronic
1060586900 9:124792327-124792349 GACACACAGGAGCCTAGATCGGG - Intronic
1060586905 9:124792358-124792380 GACACACAGGTGCCTAAATCAGG - Intronic
1062011257 9:134268056-134268078 GACAATCGGTTGCCAAGGTCAGG - Intergenic
1203432016 Un_GL000195v1:99857-99879 GAAATTCTGTTTCCTAGATCAGG + Intergenic
1203434476 Un_GL000195v1:124703-124725 GAAATTCTGTTTCCTAGATCAGG - Intergenic
1186161520 X:6781933-6781955 GACACAGTGTTGCCTGGATTTGG + Intergenic
1186749414 X:12606329-12606351 GCCACTCTCTTGCCTAGAGAAGG - Intronic
1197040049 X:121925934-121925956 CTCACTCTGTTGCCCAGAGCTGG - Intergenic