ID: 978153857

View in Genome Browser
Species Human (GRCh38)
Location 4:105467638-105467660
Sequence CAGGAGGTTACAACTGATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 103}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978153857 Original CRISPR CAGGAGGTTACAACTGATCA AGG Intronic
900171806 1:1273077-1273099 CAGGAGGTGACACCTGGCCAGGG + Intronic
902880721 1:19370207-19370229 CAGGCGGTTCCCACTGCTCAGGG + Intronic
903803871 1:25990285-25990307 CAGGAGGGGAAAACAGATCAAGG + Intronic
913070718 1:115296092-115296114 GAGGAGGTAACATCTGAGCAGGG + Intronic
915627447 1:157124024-157124046 CAAGAGTTTACAACTCCTCATGG + Exonic
919425342 1:197423205-197423227 CATGAGGTTAATACTGACCATGG + Intronic
920992549 1:210953595-210953617 GAGGAGGTTACACCTGAGCCAGG - Intronic
924356022 1:243176768-243176790 GAGGAGGTTACGTCTGATAAAGG + Intronic
924826882 1:247549080-247549102 CAGGACGTTGCATCTGACCACGG - Intronic
1063193883 10:3721848-3721870 CAGGAGCTTTCAACTGATAAAGG + Intergenic
1081102292 11:39019577-39019599 CAGGAGGTTGCACCTGTTTAAGG - Intergenic
1082216812 11:49581033-49581055 CAGGATTTTACAATTAATCAAGG - Intergenic
1084026096 11:66450698-66450720 CTGGGGATTACAACTGAACATGG + Intronic
1086632738 11:89043038-89043060 CAGGATTTTACAATTAATCAAGG + Intronic
1087422945 11:97954377-97954399 AATGAGGTGACACCTGATCAGGG - Intergenic
1095651431 12:44615141-44615163 CAGGGGGTTGCAAGAGATCAAGG + Intronic
1099141622 12:78983691-78983713 CAATAGGTTACATCTGATGATGG + Intronic
1099821382 12:87715366-87715388 CAAGAGGTAACAACTGCTCTAGG - Intergenic
1101485579 12:105155284-105155306 CAGGAGGTGACATTTGAGCAGGG + Intronic
1104619737 12:130302048-130302070 GAGGAGGTAACATCTGAGCAGGG - Intergenic
1104892331 12:132146193-132146215 CAGGAAGTAACCACTGATCCAGG - Intronic
1108282475 13:48873777-48873799 GAGGAGCTTGCATCTGATCAGGG + Intergenic
1112946875 13:104939421-104939443 CAGGAGGTCACAAACGATGAGGG + Intergenic
1114406404 14:22461011-22461033 CAGGAAGTTTCTGCTGATCACGG - Intergenic
1114729501 14:24976650-24976672 CAAGATGTTACAATTTATCAGGG + Intronic
1122462334 14:101905835-101905857 GAGGAGGTGACATCTGAGCAAGG - Intronic
1124443540 15:29707871-29707893 CAGGAGGTTACAAAAGGTCATGG + Intronic
1128649998 15:69403890-69403912 GAGGTGGTTACAGCTTATCATGG + Exonic
1128874164 15:71188507-71188529 CAGGAGGATTCAACTGGTCCTGG + Intronic
1130479799 15:84350732-84350754 CAGGAGGTGAGAGCTGATTATGG - Intergenic
1130491971 15:84437397-84437419 CAGGAGGTGAGAGCTGATTATGG + Intergenic
1130926541 15:88389797-88389819 CAGGAGGCTTCACCTGGTCATGG - Intergenic
1132230838 15:100182717-100182739 CAGGGGGTGACAACTGATGGAGG + Intronic
1133139092 16:3731381-3731403 CATGAGGTCACAGCTGAGCAGGG + Exonic
1137578411 16:49619116-49619138 GAAGAGGTTACACCTAATCAGGG - Intronic
1137824965 16:51485393-51485415 CAGGAAGTAACAACAGATCTTGG - Intergenic
1138413375 16:56856994-56857016 CAGGTAGTGACTACTGATCATGG + Intergenic
1140775731 16:78247477-78247499 AAGGAGGGTACAGCTGACCAGGG + Intronic
1140779322 16:78280077-78280099 CAGGCAGTTACAGCTAATCATGG + Intronic
1148692672 17:49540593-49540615 CAGGAGGTTACAAGAAAGCAGGG - Intergenic
1149125975 17:53233491-53233513 TAGGATGTTACAAATGAGCAAGG + Intergenic
1149137793 17:53390711-53390733 CAAGCTGTTACAACTGCTCAAGG - Intergenic
1150198243 17:63324344-63324366 CAGGGGGTGTCAAATGATCATGG + Intronic
1156358380 18:36362188-36362210 CAGGGGGTTACATCTGATCAAGG - Intronic
1158711357 18:59840936-59840958 GAGGAGGTTACATATGAACAAGG + Intergenic
1159413721 18:68116386-68116408 CAGGAGATTACAAGTGAACAAGG + Intergenic
1160483677 18:79267442-79267464 CAGAAGGTGAAAACTAATCAAGG - Intronic
1162084891 19:8242585-8242607 GAGGAGGTGACAACTGAGCTGGG + Intronic
928784739 2:34869512-34869534 CAAGTTTTTACAACTGATCAAGG - Intergenic
938196309 2:129331840-129331862 CAGGAGGCGACCACAGATCACGG - Intergenic
943787424 2:191893596-191893618 GAGCAGGTTGCCACTGATCAAGG + Intergenic
943847862 2:192674696-192674718 CTGGTGGTTACAGCTGATCTGGG - Intergenic
947342738 2:229156994-229157016 CATGAGGTGACATTTGATCAGGG - Intronic
947525933 2:230876803-230876825 CAGGAGGTGACAGCTGACCCAGG - Intronic
1170367062 20:15609559-15609581 CAGGATTTTACAAATGTTCATGG - Intronic
1172021617 20:31918745-31918767 CAGGAGCTTCCAACAGTTCACGG - Intronic
1179018879 21:37619581-37619603 CTACAGTTTACAACTGATCAAGG - Exonic
1179081081 21:38171202-38171224 CAGGGTGTTACAGCTGATAAAGG + Intronic
1184310544 22:43638469-43638491 CAGGAGGTCACAACATTTCAGGG + Intronic
1184565386 22:45288832-45288854 CAGGAGGTGGCAGCTGATCCAGG + Intronic
949931558 3:9082649-9082671 CAGGAGGCTGCAGCTGCTCAGGG - Intronic
950446191 3:13040243-13040265 CAGGAGGTGGCATCTGATCCGGG - Intronic
952168487 3:30777906-30777928 CAGGAAGTGACATCTGGTCATGG - Intronic
957578284 3:82036803-82036825 CAGAGGGTCACAGCTGATCATGG - Intergenic
958805136 3:98801161-98801183 CAGAAGATGACAACTCATCATGG + Intronic
958888614 3:99757615-99757637 CATGAGGTCAGAACTGATAAAGG - Intronic
961640637 3:128362691-128362713 CACCAGGTAACAACTGACCATGG + Intronic
961857598 3:129888198-129888220 CAGGAGGTTACATATAAGCAAGG + Intronic
966038283 3:175447420-175447442 TAGGAGATTAAAAATGATCATGG - Intronic
972961199 4:44454164-44454186 CAGGAGGCTAAAACTGGTGATGG + Intergenic
973633296 4:52839286-52839308 CAGGAGGATACAACTTGTCGAGG - Intergenic
978153857 4:105467638-105467660 CAGGAGGTTACAACTGATCAAGG + Intronic
979245789 4:118502861-118502883 GAGGAGGTTACGTCTGATAAAGG - Intergenic
982465039 4:155719752-155719774 CAGTAGGTGACAAGTGAACACGG + Intronic
988557420 5:32249777-32249799 AAGGAGATTACAACTGATCTTGG + Intronic
990371180 5:55119866-55119888 AAGGAGATTGCAACTGGTCAAGG - Exonic
992085703 5:73276310-73276332 AGGGTTGTTACAACTGATCAAGG - Intergenic
994069897 5:95589096-95589118 GAGGAGGTAACAACTGAGCTGGG - Intronic
999806901 5:155089753-155089775 GAGGTGGTTACACCAGATCAGGG - Intergenic
1000631842 5:163599612-163599634 CAGGAGGTTAGAAGAGATGAAGG + Intergenic
1001523878 5:172414959-172414981 GAGGAGGTGACATCTGAGCAGGG - Intronic
1002104832 5:176874861-176874883 AAGGAGCTTGCAACTGAGCAGGG + Intronic
1002164516 5:177336197-177336219 GAGGAGGTAACATCTGAGCAAGG + Intronic
1011222047 6:85064842-85064864 CAGGAGGGTAGAACTGAAGAGGG - Intergenic
1016683061 6:146852723-146852745 CAGGTGGTGATAATTGATCATGG + Intergenic
1023271693 7:38470029-38470051 CAGGATGTTCAACCTGATCAAGG - Intronic
1024647607 7:51383108-51383130 CAGGAGTGTACAACGGATCGTGG + Intergenic
1030632812 7:111914047-111914069 GAGGAGGTAACACCTGAGCAGGG - Intronic
1031110619 7:117604135-117604157 CAGGAGATTTGAAGTGATCAAGG + Intronic
1033372244 7:140720135-140720157 TAGGATCATACAACTGATCAGGG - Intronic
1034365016 7:150538854-150538876 CAGGAGGTTAACATTGTTCATGG + Intergenic
1038893445 8:31754094-31754116 CAGCAGGTTAACATTGATCAAGG - Intronic
1042959882 8:74292315-74292337 CAGGGGGTTCCAAGTGAGCATGG - Intronic
1045401419 8:101822673-101822695 CAGGAGCTCACAGCTGTTCAAGG - Intronic
1047692630 8:127371884-127371906 GAGGAGGTCACAACTGAGCCAGG - Intergenic
1048538389 8:135319093-135319115 CAGGAGATTCCAAATTATCAGGG - Intergenic
1048826719 8:138434908-138434930 CAGGAGGGTAGAACTGCTCAGGG - Intronic
1049132499 8:140860130-140860152 CAGGGAGGTACAACTGTTCATGG - Intronic
1049524788 8:143118021-143118043 CTGGAACTTACATCTGATCATGG - Intergenic
1057610282 9:96536805-96536827 CAGGAGGCTACAACTACTCTGGG + Intronic
1058096322 9:100864405-100864427 CTGAAGGTGACAACTGATCTTGG + Intergenic
1058413436 9:104760592-104760614 CTGGAGGTAAAAACTTATCACGG + Intergenic
1059716962 9:116921963-116921985 CTGGATATTACAACTGAACATGG + Intronic
1060460784 9:123852472-123852494 GAGGAGTTTACATCTGATGAGGG - Intronic
1062337297 9:136077657-136077679 CAGGCGGTGACACCTGAGCAGGG + Intronic
1190543824 X:51504388-51504410 CAGAAGGTGAGAAGTGATCAAGG - Intergenic
1191776752 X:64822871-64822893 CAGGAGGTTCCTAATAATCAGGG - Intergenic
1199085793 X:143629539-143629561 TAAGAGATTGCAACTGATCAAGG + Exonic
1199908014 X:152254861-152254883 CAGGAAGTGACAACTGATATCGG + Intronic
1200424925 Y:3009783-3009805 CAGGAGGTTGCACGTGCTCAGGG - Intergenic