ID: 978153982

View in Genome Browser
Species Human (GRCh38)
Location 4:105468792-105468814
Sequence CCTCATGCATTAGACCTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 94}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978153977_978153982 22 Left 978153977 4:105468747-105468769 CCCTCTCAGCTCTTCATTCACTT 0: 1
1: 0
2: 3
3: 44
4: 433
Right 978153982 4:105468792-105468814 CCTCATGCATTAGACCTGCATGG 0: 1
1: 0
2: 0
3: 9
4: 94
978153976_978153982 29 Left 978153976 4:105468740-105468762 CCTACTTCCCTCTCAGCTCTTCA 0: 1
1: 0
2: 4
3: 49
4: 511
Right 978153982 4:105468792-105468814 CCTCATGCATTAGACCTGCATGG 0: 1
1: 0
2: 0
3: 9
4: 94
978153978_978153982 21 Left 978153978 4:105468748-105468770 CCTCTCAGCTCTTCATTCACTTT 0: 1
1: 0
2: 4
3: 36
4: 510
Right 978153982 4:105468792-105468814 CCTCATGCATTAGACCTGCATGG 0: 1
1: 0
2: 0
3: 9
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978153982 Original CRISPR CCTCATGCATTAGACCTGCA TGG Intronic
902986838 1:20159880-20159902 CCTCATGCTTCAGCCATGCACGG - Intergenic
908081646 1:60586315-60586337 CATCATACACTAGAACTGCAGGG + Intergenic
922793313 1:228322717-228322739 CAACATGCATTTGAACTGCATGG - Intronic
1064205852 10:13322844-13322866 CCTCATGCACGGGACCTGCCCGG - Exonic
1071089557 10:81902562-81902584 CCTCATGAAATAGACCTGCCAGG + Intronic
1075069139 10:119309091-119309113 CCTCACGCACCAGCCCTGCAGGG - Intronic
1075112758 10:119600996-119601018 CCTCAGCCATTAGACCACCAGGG + Intergenic
1076426119 10:130368887-130368909 CCTCATTCACCAGACGTGCATGG + Intergenic
1077742878 11:4867002-4867024 CCTCATGCCTATGACCTGAATGG - Intronic
1084570396 11:69956355-69956377 GCTCATGCATTAAAGCTGAAAGG - Intergenic
1088139923 11:106603913-106603935 CATCATGCAAGAGAACTGCAAGG + Intergenic
1089600399 11:119610824-119610846 CCTCAAGCAATCCACCTGCATGG + Intergenic
1092240535 12:6833603-6833625 CCTCAGGGATGAGAGCTGCAGGG - Exonic
1093756118 12:22853792-22853814 CATCATGCATTAGATCTGGAAGG - Intergenic
1097347440 12:58509594-58509616 CCACATGCATTAAACATTCATGG + Intergenic
1105777842 13:23679692-23679714 CCTCTTGCATCAGCCTTGCAAGG - Intergenic
1107168897 13:37316779-37316801 CTTCATGCTTTAACCCTGCAGGG + Intergenic
1116067415 14:40001767-40001789 CCTCATCCATTTCACTTGCAGGG - Intergenic
1117375919 14:55118119-55118141 CCACATGCATTAGAACTGTGGGG + Intergenic
1121713696 14:96057789-96057811 CCTCCTGCATTGTACCTGGAAGG + Intronic
1122067000 14:99180821-99180843 CCTCATGCATTAGAGGTTCTAGG + Intronic
1127855576 15:62950879-62950901 CCTCATGCATTAACCATGCATGG + Intergenic
1130050353 15:80479097-80479119 TCTCATTCGTTGGACCTGCAGGG + Intronic
1132415490 15:101615898-101615920 CCTCATGCATTCTACCGACATGG - Intergenic
1133240842 16:4413454-4413476 CCTCTTGCTTTAGGCATGCATGG - Intronic
1137041427 16:35616335-35616357 CCTCATGCTTCAGCCATGCATGG + Intergenic
1137052081 16:35722957-35722979 CCTCATGCATGAGACAAGGAAGG - Intergenic
1138550443 16:57744838-57744860 ACTCATTCATGTGACCTGCAGGG - Intronic
1142244565 16:88963841-88963863 CCTCCTGCCTCAGACGTGCACGG - Intronic
1143698695 17:8640677-8640699 CCTGATGGATCAGACCTGTAGGG + Intergenic
1144050609 17:11494546-11494568 CCTCTTGCATTAGAACTCCTAGG + Intronic
1145259842 17:21348175-21348197 CCTCTTGCTTGAGTCCTGCAAGG + Intergenic
1145316773 17:21739763-21739785 CCTCTTGCTTGAGTCCTGCAAGG - Intergenic
1146606026 17:34258399-34258421 CCTAAAGCATTCGACCTGCCTGG + Intergenic
1146906723 17:36622758-36622780 CCTCATGCCATACCCCTGCAGGG - Intergenic
1147345832 17:39794250-39794272 CCTCATGCACTAGACATATAAGG + Intronic
1147631447 17:41934855-41934877 CCTCAGGCAATAGAACTGTAGGG - Intronic
1150623977 17:66829693-66829715 CCTGGTGCCTTAGCCCTGCAGGG + Intergenic
1153910603 18:9703198-9703220 CCCCATGCTTTAACCCTGCAAGG + Intergenic
1154996097 18:21641650-21641672 CCTCATCCATCAAACCTGAAAGG + Intergenic
1159945393 18:74441147-74441169 CCTCATTCCTTAAACCTGAAAGG - Intronic
1160130166 18:76218354-76218376 CCTCATGCACTGGAACTGGAAGG - Intergenic
1160715868 19:576277-576299 CCTCATCCTCCAGACCTGCAGGG - Intronic
1166268201 19:41697635-41697657 CCACATGTATTGTACCTGCAGGG - Intronic
1167870594 19:52366657-52366679 CCACATGCATTACACTTGTAAGG - Exonic
1167938747 19:52928558-52928580 CCACATTCATTACACTTGCAAGG + Exonic
1167990117 19:53352659-53352681 CCACATTCATTACACCTGTAAGG - Exonic
1168397172 19:56058232-56058254 CCACATGCCTTCAACCTGCAGGG - Exonic
1168633807 19:57978539-57978561 CCACATTCATTACACCTGTATGG + Exonic
925031257 2:651421-651443 CCTCATGCATGGGCTCTGCATGG + Intergenic
926215141 2:10901720-10901742 CCTCATGCACTTGACTTCCAGGG + Intergenic
926674222 2:15606259-15606281 ACTCAGGTATTATACCTGCAAGG + Exonic
928710329 2:33997699-33997721 CCTCAGGCTTCAGACCTACATGG - Intergenic
929570727 2:43021410-43021432 CCACAGGCATTATTCCTGCAGGG + Intergenic
939537307 2:143447825-143447847 CCTCATGCATAAAATCTGTAAGG - Intronic
948463854 2:238142999-238143021 CCTCATGCGCTCCACCTGCAAGG - Intronic
1170706617 20:18749555-18749577 CCTCCTGGATGAGACTTGCAGGG + Intronic
1174085889 20:48006880-48006902 CCTCCTGCCTTTGACCTCCAGGG + Intergenic
1175306617 20:57980187-57980209 CCTGCTGCCTGAGACCTGCAGGG - Intergenic
1175327472 20:58139914-58139936 CCTCATGCATGTGAAGTGCATGG - Intergenic
1177353604 21:19978366-19978388 ACTCATGCAAGAGACCTGCCGGG + Intergenic
1177580670 21:23018415-23018437 CCTCATTCATTAGACATGAATGG + Intergenic
1182300866 22:29336169-29336191 CCTCATTCCTTAGACCAACATGG + Intronic
954587767 3:51751576-51751598 CCCCATGCAGTGGCCCTGCAGGG - Intergenic
961427431 3:126859045-126859067 CCTGATGAATCAGACCAGCAAGG - Intronic
962463863 3:135639051-135639073 CCTCATCCATCAGACCTGACTGG + Intergenic
962532077 3:136291798-136291820 CCTCATGCTTCTGACATGCATGG - Intronic
964445123 3:156750522-156750544 CTTCCTGCATTAGCCATGCATGG - Intergenic
964513233 3:157476674-157476696 GCTCATGTATTCTACCTGCAGGG - Intronic
965942338 3:174200208-174200230 CTTCTTGCATTAGCACTGCAAGG - Intronic
967493574 3:190119964-190119986 CCTCATGAATTAGTGCTGAATGG + Intronic
968580898 4:1394499-1394521 GCTCATGCATAAGAGGTGCAGGG - Exonic
970313938 4:14811337-14811359 CCTCACCTATTAGACCTGCAAGG + Intergenic
971955412 4:33411200-33411222 CAACATGCAGTAGCCCTGCAGGG + Intergenic
977767361 4:100815357-100815379 CCTCATGCTTTAGTCCTGCCAGG + Intronic
978153982 4:105468792-105468814 CCTCATGCATTAGACCTGCATGG + Intronic
986025486 5:3846591-3846613 CCTCTTGCTTTATACATGCAGGG + Intergenic
987300832 5:16596924-16596946 TCTCATGCTTTAGATCTTCAGGG - Intronic
989467907 5:41778686-41778708 CCACATGCATTAGACAGGTAAGG + Intronic
994713204 5:103291233-103291255 CCTAATGAATTAGACCAGCATGG + Intergenic
998205026 5:140151937-140151959 CTTGATTCATAAGACCTGCATGG - Intergenic
1003159222 6:3621066-3621088 CCTCATGGATTTGCCCTCCATGG + Intergenic
1005070909 6:21861510-21861532 CCTCCTGCCTTCGACATGCAAGG - Intergenic
1006751579 6:36381162-36381184 CCTCCTGCATTCTTCCTGCAAGG - Intronic
1007207420 6:40164107-40164129 CCTCATTCATGTGACTTGCAGGG - Intergenic
1016681728 6:146837957-146837979 ACTCATGCATTAGTTCTACAAGG - Intergenic
1017902516 6:158730689-158730711 CCTCATGCATAAGACAAGGAAGG + Intronic
1018236306 6:161727251-161727273 ACTAATGCATTTGCCCTGCAGGG - Intronic
1021849164 7:24790981-24791003 CCTCATGCTTTGGCCATGCATGG + Intergenic
1028791171 7:94854724-94854746 CCTCAAGCACTAAAACTGCAAGG + Intergenic
1030411584 7:109188123-109188145 CCTCACTCATTAGAAATGCAGGG - Intergenic
1033555834 7:142487993-142488015 CAGCATTCATTGGACCTGCAGGG - Intergenic
1038667837 8:29556418-29556440 TCTCCTGCACAAGACCTGCAGGG + Intergenic
1042383062 8:68141379-68141401 CATCATGGATGAGACATGCATGG + Intronic
1044247288 8:89963826-89963848 CCTGATGCCTTGGACCAGCATGG - Intronic
1046798066 8:118393900-118393922 CCCCATGCATTTGATCTGAAAGG + Intronic
1047716626 8:127601744-127601766 CCTCATGAATTTGACCTGGATGG - Intergenic
1048476629 8:134748287-134748309 CCTCAGGCAATAAACCTACAAGG - Intergenic
1050787146 9:9418109-9418131 CCACATACATAAGACTTGCATGG + Intronic
1055395936 9:75875301-75875323 CCTCATGAATGAAACCTGAAGGG + Intergenic
1055807214 9:80109486-80109508 CCTCAGGCATCTGACCAGCAGGG - Intergenic
1191885669 X:65885515-65885537 CCTAATGCATTTCACATGCATGG - Intergenic
1192727814 X:73770177-73770199 CCTCATGCATGGGACCTGCCCGG + Intergenic
1202037515 Y:20649394-20649416 CCTCATGCTTCAGCCATGCATGG - Intergenic