ID: 978155744

View in Genome Browser
Species Human (GRCh38)
Location 4:105488021-105488043
Sequence CTCAAACCTATGCTGCTCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978155742_978155744 24 Left 978155742 4:105487974-105487996 CCAGGTAATGAAGAAAAGATAGA No data
Right 978155744 4:105488021-105488043 CTCAAACCTATGCTGCTCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978155744 Original CRISPR CTCAAACCTATGCTGCTCGA AGG Intergenic
No off target data available for this crispr