ID: 978159684

View in Genome Browser
Species Human (GRCh38)
Location 4:105530679-105530701
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978159679_978159684 7 Left 978159679 4:105530649-105530671 CCTTGGCGCACTAAGGGGCCATT No data
Right 978159684 4:105530679-105530701 TAAGGTCATGAATTTAAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr