ID: 978163886

View in Genome Browser
Species Human (GRCh38)
Location 4:105583413-105583435
Sequence CTGCTTCCTGTTCCTTAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 324}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978163877_978163886 15 Left 978163877 4:105583375-105583397 CCTCTCCCCAGCGTCCTCCTACC 0: 1
1: 0
2: 3
3: 70
4: 605
Right 978163886 4:105583413-105583435 CTGCTTCCTGTTCCTTAAATAGG 0: 1
1: 0
2: 1
3: 34
4: 324
978163876_978163886 28 Left 978163876 4:105583362-105583384 CCAAATCTCTTATCCTCTCCCCA 0: 1
1: 0
2: 5
3: 56
4: 496
Right 978163886 4:105583413-105583435 CTGCTTCCTGTTCCTTAAATAGG 0: 1
1: 0
2: 1
3: 34
4: 324
978163880_978163886 9 Left 978163880 4:105583381-105583403 CCCAGCGTCCTCCTACCTGGCCA 0: 1
1: 0
2: 0
3: 18
4: 182
Right 978163886 4:105583413-105583435 CTGCTTCCTGTTCCTTAAATAGG 0: 1
1: 0
2: 1
3: 34
4: 324
978163884_978163886 -6 Left 978163884 4:105583396-105583418 CCTGGCCACACATTGCTCTGCTT 0: 1
1: 0
2: 2
3: 18
4: 232
Right 978163886 4:105583413-105583435 CTGCTTCCTGTTCCTTAAATAGG 0: 1
1: 0
2: 1
3: 34
4: 324
978163882_978163886 1 Left 978163882 4:105583389-105583411 CCTCCTACCTGGCCACACATTGC 0: 1
1: 0
2: 0
3: 11
4: 177
Right 978163886 4:105583413-105583435 CTGCTTCCTGTTCCTTAAATAGG 0: 1
1: 0
2: 1
3: 34
4: 324
978163879_978163886 10 Left 978163879 4:105583380-105583402 CCCCAGCGTCCTCCTACCTGGCC 0: 1
1: 0
2: 3
3: 27
4: 369
Right 978163886 4:105583413-105583435 CTGCTTCCTGTTCCTTAAATAGG 0: 1
1: 0
2: 1
3: 34
4: 324
978163881_978163886 8 Left 978163881 4:105583382-105583404 CCAGCGTCCTCCTACCTGGCCAC 0: 1
1: 0
2: 0
3: 21
4: 271
Right 978163886 4:105583413-105583435 CTGCTTCCTGTTCCTTAAATAGG 0: 1
1: 0
2: 1
3: 34
4: 324
978163883_978163886 -2 Left 978163883 4:105583392-105583414 CCTACCTGGCCACACATTGCTCT 0: 1
1: 0
2: 1
3: 10
4: 241
Right 978163886 4:105583413-105583435 CTGCTTCCTGTTCCTTAAATAGG 0: 1
1: 0
2: 1
3: 34
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978163886 Original CRISPR CTGCTTCCTGTTCCTTAAAT AGG Intronic
900075070 1:807872-807894 CTGTTTCCTGTTTCTTTACTAGG - Intergenic
901677473 1:10894551-10894573 CTGCCTAGTGTTCCTTCAATGGG - Intergenic
902890408 1:19439149-19439171 TTGCTTCCTGTCCCTCAGATGGG - Intronic
903201680 1:21745171-21745193 ATGCTTGCTGTACCTTATATAGG - Intronic
903474449 1:23609794-23609816 CTGCTTCCTCATCCGTAAAATGG + Intronic
906950665 1:50332821-50332843 CTGCTTCCTGTCTCTGTAATGGG - Intergenic
907265146 1:53254713-53254735 CTGCTTACCATTCCTTTAATAGG - Intronic
907477487 1:54715353-54715375 CTGTTCCCTGTTCCTTCCATGGG + Intronic
907785147 1:57604073-57604095 CTGCTTCCTGTCACCTCAATGGG + Intronic
907806314 1:57823821-57823843 CTGCTTCCTCATCCATAAAGTGG - Intronic
908077724 1:60539286-60539308 ATGGTTCCTGTTCCTTATAATGG + Intergenic
909692449 1:78423921-78423943 CTGCTTCCTGTTTTATAAAATGG - Intronic
911416324 1:97579390-97579412 CTGTGTCCTGTTACTTACATTGG - Intronic
911739299 1:101369693-101369715 ATGCTTCCTGTTCATGGAATTGG + Intergenic
911889438 1:103348513-103348535 CAGTTTCCTGTTCCTTAAAAAGG - Intergenic
912714958 1:111976838-111976860 ATGTTGCCTGTTCCTTACATTGG + Intronic
912770361 1:112458203-112458225 CTGATTGCTGTTACTTGAATAGG + Exonic
913063833 1:115231747-115231769 CTGTTTCCTGATCTTTAAAATGG - Intergenic
913532115 1:119740841-119740863 CAGCATCCTGTTGCTTAATTAGG - Intronic
914897596 1:151690805-151690827 CAGTTTCCTCTTCCATAAATGGG - Intronic
915428265 1:155845024-155845046 CTGCTTCCTGTTGATTTTATGGG - Intronic
916796606 1:168173316-168173338 CTTCTTGCTCTTCCTGAAATGGG + Intergenic
919338971 1:196278996-196279018 CTGCTTCCTGGTTCTCAGATAGG - Intronic
920373149 1:205492232-205492254 CTGCCTCCTCTTCCTGACATGGG - Intergenic
922270910 1:224032771-224032793 CTGTTTCCTGTTTCTTTACTAGG - Intergenic
923048698 1:230374878-230374900 AAGCTTCTTATTCCTTAAATAGG + Intronic
923523623 1:234755868-234755890 CTTCTCCCTGTTTTTTAAATGGG + Intergenic
924705022 1:246493891-246493913 CTGCTTCCTTGCCCTTTAATCGG + Intronic
1062826126 10:570289-570311 CTGTTTCCTGATCCATAAAATGG - Intronic
1062928175 10:1333703-1333725 CTGCTTCCTTTTCATTTTATTGG - Intronic
1064382273 10:14856451-14856473 CTGCTTCCCGTTCCTTGCTTAGG + Intronic
1064614588 10:17139581-17139603 CTGCCTCTTGTACCTTTAATTGG + Intergenic
1065682632 10:28252760-28252782 CTGGTTGATGTTACTTAAATAGG - Intronic
1065717112 10:28581898-28581920 TTGCTTCCTGTTATTTAAAAGGG + Intronic
1070566963 10:77611024-77611046 CTGCTTCCTTGTCTGTAAATGGG + Intronic
1071495044 10:86162354-86162376 CTTCTTCCTGTTCCCTGCATGGG - Intronic
1071822849 10:89295649-89295671 TTGCTTCCTGTTCCTGGAATGGG - Intronic
1072311185 10:94156893-94156915 CTGCTCCCAGTTCCTGACATAGG - Intronic
1074910961 10:117908392-117908414 CTGCATCCAGTTCCTTTCATTGG - Intergenic
1078064226 11:8067374-8067396 CTGCTTCCTGATCTATAAACTGG + Intronic
1078351875 11:10601598-10601620 CTGCTTGCTGATCCCTACATAGG - Intronic
1080885720 11:36366072-36366094 CAACTTCCTCTTCCTTAATTGGG + Intronic
1081296800 11:41400481-41400503 CTGCTTCCAGTTCCAGACATGGG + Intronic
1083216484 11:61223429-61223451 CTGCTGCCTGTTCTTTTCATTGG - Intronic
1083219366 11:61242255-61242277 CTGCTGCCTGTTCTTTTCATTGG - Intronic
1083338114 11:61939451-61939473 CTTTTTCTAGTTCCTTAAATTGG - Intergenic
1084872587 11:72108194-72108216 GTGCTTCCTTCTCCTTAGATGGG - Intronic
1087920228 11:103858506-103858528 CTGCTTTCTGTGACTGAAATGGG + Intergenic
1088460018 11:110073089-110073111 GTGCTTCCTGTTTCTTAATAAGG + Intergenic
1088727882 11:112655672-112655694 CTGCCTCCTCTTCCTTAAGATGG + Intergenic
1090409495 11:126498031-126498053 CTGCTTCCTTGTCCATAAAATGG - Intronic
1090664990 11:128909015-128909037 CTGCTTCCTGCTCCTTCATGTGG - Intronic
1091174872 11:133548845-133548867 CTTCTTTCAGTTCCTTAAATGGG - Intergenic
1091945030 12:4531922-4531944 CTGATTCCTTTTCCCTAATTGGG - Intronic
1093110288 12:15143979-15144001 TGGCCTCCTGTTCCTTAAACAGG - Intronic
1093111464 12:15157517-15157539 CTGCTTCCTGTCCCCTAAAGTGG + Intronic
1093921209 12:24861831-24861853 CTGCTTCCTGTTTTTTCAGTGGG - Intronic
1095765660 12:45891989-45892011 TTGCTTCCTCTTCCTCAAAAAGG + Exonic
1096094354 12:48924773-48924795 GGGCTTCCTGTTCCTTACAGCGG - Intronic
1097981881 12:65743650-65743672 CTCCTTCCTTTCCTTTAAATGGG - Intergenic
1098183096 12:67869219-67869241 CTGCTGCCTGTTCCTTCCTTGGG + Intergenic
1098562064 12:71885810-71885832 CTCCTTCCCGTTCCTTATAGTGG - Intronic
1098785027 12:74742861-74742883 CTGTTTCCTTATTCTTAAATTGG - Intergenic
1099141799 12:78987126-78987148 CTGCTTCCTGGTGCATAAACTGG - Intronic
1099271008 12:80511369-80511391 CTGCTTCCTTTTCGCTAACTGGG - Intronic
1099285339 12:80708788-80708810 CTGCTTCGTGTTCCTTCTTTGGG + Intronic
1099664860 12:85614923-85614945 CTACTTCCTGTTTCTCAAAGGGG + Intergenic
1100102875 12:91130630-91130652 TTACTTCCTTTTCCTTAATTTGG - Intergenic
1100462367 12:94813202-94813224 TTTCTTTCTGTTTCTTAAATTGG - Intergenic
1100580739 12:95937930-95937952 CTGCTTCCTGTTTCATAAAGTGG + Intronic
1100815039 12:98378703-98378725 CTCTTTGCTGTTCCTTAAACTGG + Intergenic
1100891804 12:99133788-99133810 ATGCCTCCTTTTCCTGAAATTGG + Intronic
1102226127 12:111229516-111229538 CTGTCTCCTGTTCCATAAAATGG + Intronic
1102271347 12:111538214-111538236 CTGCTTTTTATTACTTAAATAGG - Intronic
1102797906 12:115704980-115705002 CTGCTTCCTGTCTGTAAAATGGG - Intergenic
1103164762 12:118761035-118761057 CAGCTTCCTTTTCATTAAAATGG + Intergenic
1103340326 12:120217416-120217438 CAGCTTCCCCTTCCTTAAAATGG + Intronic
1104303503 12:127588204-127588226 CAGCTTCCTATTCTTTATATTGG + Intergenic
1105752011 13:23429693-23429715 CAGCTTCCTCCTTCTTAAATGGG - Intronic
1106248583 13:27967910-27967932 CTGCTCGCTGTACCTTGAATTGG + Intronic
1107594244 13:41945713-41945735 CTTCTTTCTGTTCCTTAGATTGG - Intronic
1108179057 13:47822903-47822925 CAGCTTCTTGTTCCTCAAGTAGG + Intergenic
1110077285 13:71262723-71262745 CTTTTTCCTGTTCTTTAGATTGG - Intergenic
1110192834 13:72751063-72751085 TTGTTTCCTCTTCTTTAAATGGG + Intronic
1112105913 13:96239066-96239088 CTGTATTCTGTTCCTTATATGGG + Intronic
1112198994 13:97257240-97257262 CTGCTCCTTGTTCCTTAAACTGG - Intronic
1113243045 13:108361354-108361376 CTGCTTGCTTTTTCTTAAATGGG - Intergenic
1114903340 14:27094927-27094949 CTGCTACCTTTTCATTAAAGAGG + Intergenic
1115424774 14:33245474-33245496 GTGCTTCCTGGTTCTGAAATAGG + Intronic
1118588733 14:67383459-67383481 CTGCTCTGTGTTCCTTAAATTGG - Exonic
1119422661 14:74516804-74516826 CTCCTTCCCGTTCCTTACCTTGG + Exonic
1119867076 14:77982631-77982653 CAGCTTCCTCATCTTTAAATGGG + Intergenic
1121099977 14:91243771-91243793 CAGCTTCCTTTTCCTTCAGTTGG + Intronic
1121644667 14:95509562-95509584 CTGTTTCCTGCTCTTTAAAGAGG - Intergenic
1121708071 14:96015611-96015633 CAACTTCAAGTTCCTTAAATGGG + Intergenic
1121901066 14:97693918-97693940 CAGTTTCCTGCTCTTTAAATTGG - Intergenic
1122913657 14:104845813-104845835 CTGCTTCCTGGTCCATAGATGGG - Intergenic
1123696874 15:22884902-22884924 CTGCTTCCTGGTCGCTAAAAGGG - Intronic
1125083385 15:35701629-35701651 CTGTTCCCTTTTCCTTGAATAGG - Intergenic
1126585155 15:50278694-50278716 CTGCTTCCTGTTCTTTCTTTAGG + Exonic
1127051649 15:55089993-55090015 CTGCTTCCTCTTCCCTTCATAGG + Intergenic
1128680900 15:69650619-69650641 CTTCTTTCTGTTCCCTGAATGGG + Intergenic
1128716549 15:69912809-69912831 TTGCTTCCTCTTCTGTAAATTGG + Intergenic
1129126862 15:73448791-73448813 CTGCTGCCTGTTCCTTACTCTGG - Intronic
1129532596 15:76280771-76280793 CTCCTTCCTATTCGTCAAATAGG + Intronic
1129866870 15:78915537-78915559 CAGCTTCCTCTTCTATAAATGGG + Intergenic
1130423238 15:83769618-83769640 CTGCTTACTGTGCTATAAATAGG + Intronic
1131828528 15:96339611-96339633 CTGCTTTCTCTTCCTTAATTTGG - Exonic
1132796276 16:1724824-1724846 CTGCTGCCTGTTTCTGTAATGGG + Intronic
1135640733 16:24117853-24117875 CAGCTTCCTGTCCCTTGATTGGG - Intronic
1136102406 16:28005691-28005713 CAGTTTCCTATTCCTAAAATAGG + Intronic
1138082718 16:54106315-54106337 CTGCTTCCTGTTACGTCACTAGG + Intronic
1138326251 16:56172080-56172102 CTTCTTCCAGTTTCTTAAAATGG + Intergenic
1139029125 16:62858001-62858023 CTTCTTGGTGATCCTTAAATTGG + Intergenic
1139868205 16:70080671-70080693 CTGCTTCTTTTTCCTAAATTAGG - Intergenic
1140126005 16:72119577-72119599 CTTCTACCTGTTCCCTAAAATGG + Intronic
1140387128 16:74551177-74551199 CTGCTTCTTTTTCCTAAATTAGG + Intronic
1141198149 16:81877011-81877033 CTGTTTCTTGTTTCTGAAATGGG + Intronic
1141300171 16:82807693-82807715 GTGCTTCCTGTTTCTTACAGAGG + Intronic
1141663723 16:85455024-85455046 CTGTTTCCTCCTCCGTAAATGGG + Intergenic
1143006498 17:3838749-3838771 CTGCTTCCTCTTTATAAAATAGG + Intronic
1143020992 17:3917144-3917166 CTGCTTCCTCATCTGTAAATTGG + Intergenic
1143799736 17:9368672-9368694 CTCCCTCCTTTTCCTTAAGTGGG + Intronic
1144018535 17:11220223-11220245 CAGCTTCCTGTTCCAAAAAGAGG + Intergenic
1144518247 17:15935741-15935763 TTTCTTTCTGTTCCTCAAATTGG + Intergenic
1147215754 17:38898095-38898117 CCGTTTCCTGATCCGTAAATTGG + Intronic
1148008515 17:44454940-44454962 CTGTTTCCTGCTAATTAAATGGG - Intronic
1148568496 17:48647604-48647626 CTGTTCCCTGTGCCTTACATGGG + Intergenic
1152658792 17:81532909-81532931 CTGCTTCCTGCTTCTAAAGTGGG - Intronic
1153229882 18:2925383-2925405 CTGCTGCCTCTTCCGTAACTGGG - Intronic
1153719750 18:7889793-7889815 TTTCTTCCTGTTGCTTACATGGG - Intronic
1153788808 18:8558766-8558788 GTGGTTTCTGTTCATTAAATTGG + Intergenic
1155987908 18:32249928-32249950 GTGTTTTCTGTTTCTTAAATAGG - Intronic
1156536795 18:37872184-37872206 CCTCTTCCTGCTCCTTACATGGG - Intergenic
1157757401 18:50230942-50230964 CTGATTCCTTTTCCCTAAATAGG - Intronic
1157941943 18:51938614-51938636 CTGAATCCTGCTTCTTAAATTGG + Intergenic
1158077825 18:53551903-53551925 TTGCTTCCTTTTGCTTAAATAGG - Intergenic
1159617202 18:70595057-70595079 CAGCTTTCAGTTCATTAAATGGG + Intergenic
1160743931 19:701592-701614 CTGCTTCCTATTTCTTGAAATGG + Intergenic
1164120152 19:22258662-22258684 CTCCTGCCTGTGCCTTACATGGG - Intergenic
1166605861 19:44141966-44141988 CTCCTTGCTGTTCTTTAAAATGG + Intronic
1168660267 19:58160201-58160223 CCTCTTCCTGTTCCTTGACTTGG - Intergenic
925174487 2:1772503-1772525 CAGCTTCCAGTTCCTTACACTGG + Intergenic
925758872 2:7164715-7164737 CTGTTTCCTGTTCTGTAAAAGGG - Intergenic
925841623 2:7997380-7997402 CTGTTTCCTGGTCCCTGAATTGG - Intergenic
928082038 2:28320235-28320257 CTGCTTCCTGTCCCCTTACTTGG + Intronic
928616408 2:33043957-33043979 CTGCCTCCCTTTCCTTGAATAGG - Intronic
929169743 2:38919851-38919873 CTGTTTCCTCTTCCGTAAATTGG - Intronic
930625796 2:53696552-53696574 CTTCTTCCTGCTCCTAAATTAGG - Intronic
931341376 2:61404435-61404457 CTGCTTTCTGTTACTTGAAGCGG - Intronic
931615424 2:64151597-64151619 CTGCTTGTAGTTCTTTAAATGGG - Intergenic
931826627 2:66007157-66007179 CTGCTTCCCGTCCCTTCAGTTGG - Intergenic
933699193 2:85242579-85242601 CTTCCTCCTTTTCCTTGAATGGG + Intronic
934684748 2:96312768-96312790 CTGACTCCTTTTCCTTAATTAGG - Intergenic
938672749 2:133601313-133601335 AGTCTTCCTGTTCCTTCAATTGG - Intergenic
939017429 2:136919045-136919067 TTGGTTCTAGTTCCTTAAATTGG + Intronic
939156249 2:138527826-138527848 CAGCATCCTCTTCCTTGAATGGG + Intronic
940025992 2:149209044-149209066 CTCCTTCCTGTTCATTGAAGAGG - Intronic
941602241 2:167557929-167557951 TTGCTCCCTTTTCCTTGAATGGG - Intergenic
942612598 2:177757343-177757365 TAGCTGCCTGATCCTTAAATGGG + Intronic
942648441 2:178141230-178141252 CAGCTTCCTGTTGATAAAATAGG - Intergenic
943294795 2:186124085-186124107 CTGCTCTCTGTTCTTTAATTTGG + Intergenic
944318851 2:198312354-198312376 CTTCTTCCTGTCCCTTAAGCCGG - Intronic
947157391 2:227176069-227176091 CTTCTTCCAGATCCTTAACTGGG - Intronic
947230054 2:227875497-227875519 CTCCTTGGTGTTCCTTGAATGGG + Intronic
947808137 2:232982454-232982476 TTCCTTCCTGGTCCTTGAATTGG + Intronic
947879814 2:233497899-233497921 CTACTTCCTGTTCTTTAAGAAGG - Intronic
949082653 2:242116912-242116934 CTGTTTCCTGTTTCTTTACTAGG + Intergenic
1168789590 20:567360-567382 CAGTTTTCTTTTCCTTAAATTGG + Intergenic
1169234513 20:3919646-3919668 CTGCTTCTTTTTCCCCAAATAGG - Intronic
1169344498 20:4819833-4819855 CCCTTTCCTGTTCCTTCAATTGG - Intronic
1170449930 20:16472372-16472394 CTGTTTCCTCCTCCTTAAAATGG - Intronic
1172884867 20:38224111-38224133 CTGCTTCCTCCTCTTTAAAATGG + Intronic
1172969397 20:38862354-38862376 CAGCTTCCTCTTCCATAAAATGG - Intronic
1173674719 20:44823696-44823718 TTTGTTACTGTTCCTTAAATTGG + Intergenic
1173899947 20:46580310-46580332 CTGCTTTCTGTTTCAAAAATGGG + Intronic
1173906865 20:46635789-46635811 CTGCATCCTGTTTCATGAATTGG - Intronic
1176033822 20:63026765-63026787 CTTCAACCTGCTCCTTAAATGGG - Intergenic
1177218631 21:18161548-18161570 CAACTTTTTGTTCCTTAAATGGG + Intronic
1177440870 21:21122375-21122397 CTTCTTCCTGTTACTAAATTAGG - Intronic
1177861099 21:26455156-26455178 CTCCTTGCTCTTCCTCAAATAGG + Intergenic
1178570164 21:33728527-33728549 CTTCTTCCTGTTCTTTAAATGGG + Intronic
1178603173 21:34012659-34012681 CAGTTTCCTCATCCTTAAATGGG + Intergenic
1178606927 21:34045776-34045798 CTGCTTCTTCTTTCTTAATTTGG + Intergenic
1179222094 21:39417525-39417547 TTGCTTCCTTTATCTTAAATAGG + Intronic
1179248725 21:39655639-39655661 CTGTTTTCTTTTCCTTAAAGAGG - Intronic
1180112405 21:45667375-45667397 TTACTTTCTGTTCCTTAGATTGG + Intronic
1182795518 22:32988956-32988978 CTGCTTCCTCTTCCGTAGATGGG + Intronic
949511123 3:4768196-4768218 CAGCTTCCTGATCTTTAAAATGG - Intronic
950289596 3:11772869-11772891 CTGCCTCCTGTTCTTTAAGATGG - Intergenic
950436217 3:12981913-12981935 CTGCTGCCTGTTCCATAGATGGG + Intronic
952619238 3:35316393-35316415 TTACTTCCTGTTCCTCTAATGGG - Intergenic
952636101 3:35534160-35534182 CTTCTTCCTCTTTCTTAATTAGG - Intergenic
952747015 3:36791093-36791115 CTGCTCCCTTTTCCCTAATTAGG - Intergenic
953339375 3:42120847-42120869 CTGCTTCCTGTGCTTTAAAGGGG + Intronic
953676669 3:45007939-45007961 CTGCTTCCTGTCCCTAGAAGTGG + Intronic
956167990 3:66410740-66410762 CTCCTTTCTATTCCTTTAATGGG - Intronic
956217150 3:66860385-66860407 GTGCTTCCTGATTCTTAAGTAGG - Intergenic
957244412 3:77700003-77700025 CTGATTCCTCTTCCATAAAACGG - Intergenic
957404943 3:79765369-79765391 CTGCTTCCTCTTCCTTTTTTTGG + Intronic
958190734 3:90180817-90180839 CTGCTCCCTTTTTCTTAAATTGG - Intergenic
958412922 3:93839995-93840017 CTTCTCCCTTTTTCTTAAATTGG - Intergenic
958717561 3:97803851-97803873 ATTCTTCCTTTTCTTTAAATGGG + Intergenic
959664607 3:108906466-108906488 CTGCTGCCTTTTCCCTAAATAGG + Intergenic
960133906 3:114086808-114086830 CTGCTTCCTGCTGAATAAATAGG + Exonic
961906391 3:130267256-130267278 CTACTTCTTGGTCCTTAAGTTGG + Intergenic
962065251 3:131972798-131972820 CTACTTCCTCCTCCATAAATGGG + Intronic
962170089 3:133092850-133092872 CTGTTTCCTTCTACTTAAATCGG - Intronic
965484686 3:169264209-169264231 CTACTTTCTTTTCCATAAATTGG + Intronic
967139366 3:186541310-186541332 CTCTTTCCTGTTCCCTAAAAGGG + Intronic
967537443 3:190623114-190623136 CTGCTCCCAGTTCCTGACATGGG - Intronic
968427615 4:534099-534121 CAGTTTTCTTTTCCTTAAATAGG + Intronic
968868113 4:3226839-3226861 CTGCTTCCTGTCACTGAAACCGG - Intronic
970776198 4:19677272-19677294 ATCCTTCATGTTCCTTTAATTGG - Intergenic
971873373 4:32273239-32273261 CTGCCTCCTGTTCCTATCATTGG + Intergenic
973024094 4:45245371-45245393 CTCCTTTCTGTTCCTCAAACAGG - Intergenic
973200928 4:47501329-47501351 CTGCTTACTGTGCCTTATAGAGG - Intronic
977935059 4:102792445-102792467 CAGCTTCCTTTTCCCTAACTAGG - Intergenic
978163886 4:105583413-105583435 CTGCTTCCTGTTCCTTAAATAGG + Intronic
978465728 4:109006796-109006818 TGGTTTTCTGTTCCTTAAATAGG - Intronic
984483270 4:180333429-180333451 CTCCTTGCTGTTCCTTGAACAGG - Intergenic
984596773 4:181677834-181677856 CTTATTTCAGTTCCTTAAATAGG + Intergenic
984975765 4:185228871-185228893 CTGCTTCCTGATCCATACAATGG - Intronic
985352752 4:189083669-189083691 CTGACTCCTCTTCCCTAAATAGG - Intergenic
985875219 5:2589401-2589423 GTTCTTCCTGTTTCTTAATTGGG + Intergenic
986363866 5:7009653-7009675 CTGTTTCCTTTTCTTTAAAATGG - Intergenic
986418147 5:7549211-7549233 CTGCTTCCTGTTGCTACATTAGG + Intronic
986970446 5:13329087-13329109 CTTCTATCTGTTCATTAAATTGG - Intergenic
987211132 5:15684432-15684454 CTGATTCATTTTCCTAAAATTGG - Intronic
989245430 5:39249118-39249140 CTGCTTACTGTTCCCTACACTGG - Intronic
989814092 5:45714351-45714373 CTTCTTCCTGTTGCTTGAAGAGG - Intergenic
990121699 5:52462404-52462426 CTGCTTCCTGTGTCTGAAATGGG + Intergenic
990220078 5:53578593-53578615 CTGTGTCCTGTTCCGTAAAATGG + Intronic
990369633 5:55104253-55104275 TTGCTGTCTGTTCCTTATATGGG - Intronic
992618321 5:78567660-78567682 CTGCTTCCTCATCCTTAAAATGG - Intronic
992976807 5:82129691-82129713 TTGCTTCCTGTTCCTTCATCTGG + Intronic
994288995 5:98004575-98004597 CTGCTGCCTGTTACTTCATTTGG - Intergenic
995767182 5:115631412-115631434 CTATTTCCTATTCTTTAAATAGG + Intronic
995786527 5:115836110-115836132 ATGTTTCCTATTGCTTAAATGGG + Intronic
996698991 5:126430143-126430165 CTGCTTCTTTATCCTTAAAGAGG + Intronic
996758223 5:126958192-126958214 CTGCTTTCTGTTTCTTAGATGGG + Intronic
998483306 5:142480718-142480740 CTGTTTCTTCTTCCTTAAAAGGG + Intergenic
998615302 5:143733898-143733920 CTCATTCCTGTTACTTAAACTGG - Intergenic
998736400 5:145146071-145146093 CTGTTTCCTATTGCTTGAATGGG + Intergenic
998768303 5:145512777-145512799 TTGCTTCCTGTTCCTTCCTTTGG - Intronic
998783760 5:145686653-145686675 CTGCTTCCCGTTTCATGAATGGG - Intronic
999224640 5:150010962-150010984 CTGCTTCCTTTTCTTGAAATGGG + Intronic
999255720 5:150209137-150209159 CTGCTTCCTGGTCTGTAATTCGG - Intronic
999448072 5:151657288-151657310 CTCCTTTCTGTTCCTGAAACAGG - Intergenic
999619604 5:153459271-153459293 GCCCTTTCTGTTCCTTAAATAGG + Intergenic
999929147 5:156411590-156411612 TTGTTTCCTGTTCCATAAAGTGG + Intronic
1000155678 5:158549324-158549346 CAGCTTCCTCATCTTTAAATGGG - Intergenic
1000163449 5:158624080-158624102 CTGCTGCCTTTCCCTTACATAGG + Intergenic
1000523150 5:162321971-162321993 CTTCTTCTTGTTCCTGACATGGG - Intergenic
1000998227 5:167980499-167980521 CTCTTTGCTGTTCCTTAAAGAGG - Intronic
1001783209 5:174388289-174388311 TTTCTTCCTGTTGCTTGAATTGG - Intergenic
1001978597 5:176021523-176021545 CTCCTTCCAGTTCCTCAAAGTGG - Intronic
1002003832 5:176215759-176215781 CTGATTCCTTTTCCCTAATTAGG - Intergenic
1002222539 5:177694847-177694869 CTGATTCCTTTTCCCTAATTAGG + Intergenic
1002238820 5:177822239-177822261 CTCCTTCCAGTTCCTCAAAGTGG + Intergenic
1004177609 6:13353803-13353825 CTACTTCCTCTTCCTTGAATGGG - Intergenic
1004368508 6:15032194-15032216 TGGCTTCCTGTTCCTTAGAAGGG + Intergenic
1004566727 6:16804939-16804961 CTGTTTCCTGATCTTTAAAATGG - Intergenic
1004669919 6:17786063-17786085 TGGCTTGCAGTTCCTTAAATTGG - Intronic
1005385753 6:25282432-25282454 CTCCTTGCTGTTCCTTGAACAGG + Intronic
1006192079 6:32215652-32215674 TTTCTTACAGTTCCTTAAATGGG + Intronic
1007462927 6:42031041-42031063 CTGCTGCATGTTCCTTATCTTGG + Intronic
1007876984 6:45114760-45114782 ATCTTTCCTGTTCCTCAAATAGG - Intronic
1008108510 6:47466767-47466789 CAGCTTCCTGCTCTTTAAATAGG + Intergenic
1008600977 6:53094400-53094422 CTTCTTCCTGTTCTTAAAAAAGG + Intronic
1009442831 6:63702603-63702625 CTGCTTCCTGTTCTTTCATTGGG - Exonic
1009993508 6:70873741-70873763 CTTTTTTCTGTTCCTTAAACTGG + Intronic
1010306278 6:74326629-74326651 CGTCTTCCTGTTCATCAAATGGG - Intergenic
1011070923 6:83382063-83382085 CTGCTTCCTTATCCTTCAAGCGG + Intronic
1011118001 6:83916209-83916231 CTGTTTCCTCTTCCTCAAATTGG - Intronic
1012579500 6:100849140-100849162 TTGGTTCCTGCTCCTTAAATTGG - Intronic
1014223968 6:118826616-118826638 CTGTTTCCTCTTCATTTAATCGG + Intronic
1014232208 6:118916412-118916434 ATGCTTCCATTTCCCTAAATAGG - Intronic
1014247922 6:119086567-119086589 CTACTTGCTTTTCCCTAAATAGG - Intronic
1014837863 6:126181022-126181044 CTGCTCATTGTTCCATAAATAGG + Intergenic
1015217234 6:130763985-130764007 CTGCTGCCCTTTTCTTAAATTGG - Intergenic
1016331464 6:142956829-142956851 CTGTTTCCTCATCCATAAATTGG + Intergenic
1016600089 6:145848623-145848645 CTGATTCCTGTTTCTAAAATTGG + Intergenic
1016715783 6:147226533-147226555 CTACTTCCTTTTCCTTCAGTTGG - Intronic
1016728154 6:147399431-147399453 CTGTTTCCTATTCCTCATATAGG + Intergenic
1018436387 6:163763001-163763023 CTACTTCCCTTTCTTTAAATTGG - Intergenic
1018461538 6:164003873-164003895 CTCTTTCCTGTTCTGTAAATTGG + Intergenic
1019890394 7:3941487-3941509 CTGCTTCCTTTTTCCCAAATGGG + Intronic
1021179126 7:17485551-17485573 CTGTTACCTGATCTTTAAATGGG + Intergenic
1021198089 7:17694549-17694571 CTAATTCCCATTCCTTAAATAGG + Intergenic
1021455885 7:20829293-20829315 CTTCTTTCTGTTACTTAAATAGG + Intergenic
1021981294 7:26058207-26058229 TTGCTTCCTGTTCCCTAGGTGGG - Intergenic
1022804406 7:33807418-33807440 CTAATTCCTGTTCCTGGAATGGG + Intergenic
1023488041 7:40708126-40708148 CTGCTTCCTGTCACTTTAAATGG - Intronic
1023868607 7:44251018-44251040 TTTCTTCTTGTTCCTTAGATGGG + Intronic
1024156899 7:46635214-46635236 CAGCTTAATGTTCCATAAATGGG + Intergenic
1024190688 7:47005016-47005038 CTGCTTTCTGTGGTTTAAATTGG - Intergenic
1024514744 7:50236985-50237007 CTGCCTCCTGTTTGGTAAATTGG + Intergenic
1024864844 7:53893680-53893702 CTGCTTCCAGATGCTTTAATAGG + Intergenic
1025859438 7:65312628-65312650 CATCTTCGTGTTCCTGAAATTGG - Intergenic
1028703820 7:93814925-93814947 CTGCTTTCTCTTCCTTAACCAGG - Intronic
1031071387 7:117165865-117165887 CAGCTTTCAGTTCCTTAAACAGG - Intronic
1031650437 7:124282471-124282493 CTTCTTACAGTTCCTCAAATGGG + Intergenic
1031701406 7:124930986-124931008 ATGCTTCCTGTTGATTAAAAAGG - Intergenic
1031704802 7:124966317-124966339 CTTCTTCCATTTCCTTAACTAGG - Intergenic
1031850662 7:126858870-126858892 CTCCTTTCTGTTCCTTGAACAGG + Intronic
1032427411 7:131832908-131832930 CTACTTACTGTTCCCTAAAATGG + Intergenic
1035540575 8:433615-433637 CTGTTTCCTGTTTCTTTACTAGG + Intronic
1037388395 8:18366445-18366467 CTGCCTCCTGTTCATTACAAGGG + Intergenic
1037540853 8:19869428-19869450 CTGTTTCCTGTTGCTTCAAAAGG - Intergenic
1037710855 8:21354412-21354434 CTACTTTCTGTTCCTTAAAAAGG - Intergenic
1037834961 8:22210227-22210249 CTGCTTCTTGGTCCATAAAATGG + Intronic
1037900011 8:22682614-22682636 CTGCTTCCTGATCCTTATCATGG - Intergenic
1038951916 8:32424434-32424456 CTGATTCCTGATCCCAAAATTGG - Intronic
1039263749 8:35802268-35802290 CTCCTTGCTGCTCCTTGAATAGG - Intergenic
1042080765 8:65048228-65048250 TGGCTTCCTGTTCCTTGAACTGG + Intergenic
1042117599 8:65449214-65449236 CTGCAACCTATTCATTAAATGGG + Intergenic
1042828293 8:73000304-73000326 CTTCTTGCTATTCCTCAAATAGG - Intergenic
1043787206 8:84418272-84418294 CTGCTTCCTCATCTGTAAATTGG + Intronic
1044207587 8:89509461-89509483 CTGCTTGCTTTTCATTAATTAGG + Intergenic
1044864043 8:96551895-96551917 CTTCTTCCTTTTTCTTAAACAGG + Intronic
1044902541 8:96963051-96963073 CTACTTACTGTTACTTAAACTGG - Intronic
1046452758 8:114415407-114415429 CTCCCTCCTGTTGCTTTAATGGG + Intergenic
1046847118 8:118930215-118930237 CTACATCCTACTCCTTAAATGGG + Intronic
1048301345 8:133253424-133253446 CTGTTTCCTCTTCCATAAACTGG + Intronic
1048786677 8:138057940-138057962 CTGCTTTATGTTCCTTTTATAGG + Intergenic
1049199344 8:141332332-141332354 CTGCTTCCTTTTCTGCAAATGGG - Intergenic
1050227098 9:3471792-3471814 CTGCTGTCTGTTCTATAAATTGG - Intronic
1050494511 9:6226790-6226812 CTGCTACCTGTTCCTTTTGTGGG + Intronic
1051150119 9:14071108-14071130 CTTCTTCCTTTTTCTTAAATTGG + Intergenic
1051765772 9:20521719-20521741 GTGCTTTCTGTTCTTTAAATAGG + Intronic
1053130190 9:35610144-35610166 CTGCTCCCTCTTCCTGAAACTGG - Exonic
1053224640 9:36343422-36343444 TTGCTTCATTTTCCATAAATTGG - Intronic
1053346604 9:37383059-37383081 CTGCCTCCTGTTTCTTGGATGGG - Intergenic
1053792087 9:41693815-41693837 CTGTTTCCTCTTGTTTAAATTGG + Intergenic
1053843352 9:42209978-42210000 CTGCTTTCTGGTTCATAAATGGG + Intergenic
1054180494 9:61905835-61905857 CTGTTTCCTCTTGTTTAAATTGG + Intergenic
1054657097 9:67675307-67675329 CTGTTTCCTCTTGTTTAAATTGG - Intergenic
1055493326 9:76828286-76828308 TTGCTTTCTGTTCCTTGAACTGG - Intronic
1059165859 9:112075949-112075971 CTTCTTGCAGTTCCTTCAATGGG - Intronic
1060264293 9:122101611-122101633 CTGCTTCCTGATCTATAAAGTGG - Intergenic
1060647873 9:125297561-125297583 CTTCTTGCTGTTCCTTGAACAGG - Intronic
1185839041 X:3371579-3371601 ATGCTTCCTGTGTCTTAATTTGG + Intergenic
1186057756 X:5668099-5668121 ATGGCTCCTGTTGCTTAAATTGG - Intergenic
1187038455 X:15567065-15567087 CTCCTTGCTGTTCCTTTAACAGG + Intronic
1187314289 X:18177945-18177967 TCTCTTCCTCTTCCTTAAATGGG + Intronic
1188012468 X:25072515-25072537 CTTCTGCCTCTTCCTTACATGGG + Intergenic
1189107761 X:38255445-38255467 CTCCTCCCTGTTCCTTAATGTGG + Intronic
1189365778 X:40387478-40387500 CTCCTTCCTGTTCCTCAATGTGG + Intergenic
1189969878 X:46407253-46407275 GTGCTTCCTGTAACTTAAACAGG - Intergenic
1190112116 X:47597475-47597497 CTTCTTCCTGTTCCTCAGATTGG - Intronic
1195376472 X:104232893-104232915 CAGCTTCCTCATCTTTAAATGGG + Intergenic
1196948479 X:120851886-120851908 CTGTTTCCTTTTCCTTAGAATGG - Intergenic
1197359281 X:125478749-125478771 CAGATTCCTGGTCTTTAAATTGG + Intergenic
1197712903 X:129684875-129684897 CTTCTTCCTGTTCCTCTAACAGG - Intergenic
1198298106 X:135306839-135306861 CTGCATAGTCTTCCTTAAATAGG - Intronic
1198455602 X:136814706-136814728 CTACTACCTTTTCCTTAACTTGG + Intergenic
1198513709 X:137381935-137381957 TTTCTTTCTGTTCCTTACATTGG - Intergenic
1200343947 X:155429374-155429396 CTGTTTCCTCATCCTTAAAATGG + Intergenic
1201236752 Y:11919264-11919286 GTGCTTCCTGTCTCTTAATTTGG - Intergenic