ID: 978167457

View in Genome Browser
Species Human (GRCh38)
Location 4:105625879-105625901
Sequence AAGAAGGATCAGCATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 511
Summary {0: 1, 1: 0, 2: 4, 3: 43, 4: 463}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978167457_978167461 -3 Left 978167457 4:105625879-105625901 CCTTCCTCATGCTGATCCTTCTT 0: 1
1: 0
2: 4
3: 43
4: 463
Right 978167461 4:105625899-105625921 CTTTGTGGCTATGCCTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978167457 Original CRISPR AAGAAGGATCAGCATGAGGA AGG (reversed) Intronic
900467230 1:2831689-2831711 AGGAAGCATCAGCTTCAGGAAGG + Intergenic
900572122 1:3363795-3363817 AAGAAGGAGAAGGAGGAGGAAGG + Intronic
901145837 1:7064153-7064175 AAGAAGGAAGAGGAGGAGGAGGG - Intronic
901795394 1:11676709-11676731 AAGAAGCACCAGCATGACAAGGG - Intronic
902054140 1:13586072-13586094 ATGAAAGTTCAGCATGAGGGTGG - Intronic
902516101 1:16990334-16990356 TGTAAGGATCAGGATGAGGATGG - Intronic
902519764 1:17009620-17009642 TAGGAGGATCAGCATGAGGCCGG - Intronic
903293258 1:22327995-22328017 TAGAAGGATCACCATGAAAATGG + Intergenic
903543694 1:24110794-24110816 AAGAAAGAGCAGAATGAGCAGGG - Intronic
904276418 1:29387609-29387631 AAGAAGGATAAGAATGGGGAGGG + Intergenic
904810617 1:33161292-33161314 CAGAGGGAGCCGCATGAGGAAGG + Intronic
904855066 1:33491564-33491586 GAGATGGATGAGCAGGAGGAAGG + Exonic
904928623 1:34068239-34068261 GAGAATGACCAGGATGAGGAAGG - Intronic
906270344 1:44472892-44472914 AAGAAGGATCAGAGGGAGAAAGG - Intronic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
906992113 1:50750525-50750547 AAGGAGGATCAGTGTGAGTAGGG - Intronic
907184509 1:52599624-52599646 AAGAAGGAGCAGGATGGGCAGGG + Intergenic
907346134 1:53782347-53782369 AGGAAGGATCAGCAAGAGAATGG + Intronic
907488078 1:54790841-54790863 AAGAAGGAGGAGGAGGAGGACGG - Intronic
907758853 1:57337968-57337990 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
908151860 1:61310742-61310764 AAGAGGGAGAAGCAGGAGGAGGG - Intronic
908714876 1:67058914-67058936 AAGAAGGATAAGCAGGATAAAGG + Intergenic
910590282 1:88922747-88922769 AAGAAGGGTCAGAATAAAGATGG - Intergenic
910698265 1:90045144-90045166 AAGAAGTATCAGCAGGAGCAAGG + Intergenic
911335586 1:96576367-96576389 CAGAAGGATTAGCAAGAGGGAGG - Intergenic
912582950 1:110736569-110736591 GACAAGGATGAGAATGAGGAGGG - Intergenic
913373794 1:118129647-118129669 AAGAAGGAAGAGAAGGAGGATGG - Intronic
914058053 1:144183179-144183201 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
914913301 1:151803296-151803318 AAGAGGGCTCAGCATGGGGGTGG - Intronic
915945064 1:160143823-160143845 GGGTGGGATCAGCATGAGGAAGG - Intergenic
918268830 1:182874916-182874938 AAGAAGGATAAGGATGATGATGG + Exonic
919191986 1:194232191-194232213 GAGAAGGAGGAGAATGAGGAAGG + Intergenic
919449334 1:197751867-197751889 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
919449350 1:197751936-197751958 AAGAAGGAGGAGGAGGAGGAAGG + Intronic
919981793 1:202646413-202646435 AGGAAGGATAAGCGTGATGAGGG - Intronic
920304447 1:205009623-205009645 GAGCAGGATCAGCACCAGGAGGG - Exonic
921013319 1:211163258-211163280 AAGATGGATCATTAGGAGGAGGG - Intergenic
921279153 1:213548720-213548742 AAGTAGGATTGGGATGAGGAGGG + Intergenic
921396866 1:214677825-214677847 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
921657836 1:217761979-217762001 GAGGTGGAACAGCATGAGGACGG - Intronic
921761788 1:218923502-218923524 AGGATGGAGTAGCATGAGGAAGG - Intergenic
923475302 1:234326086-234326108 AGGAAGGAGCAGGAGGAGGATGG + Intergenic
924608680 1:245556345-245556367 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
1063578868 10:7287395-7287417 AAGAAGTATCAGACTGTGGAGGG + Intronic
1064272669 10:13879659-13879681 AAGAAGGAGGAGGAAGAGGAAGG - Intronic
1065662928 10:28024821-28024843 AAGAAGGATCTTCATGGAGATGG - Intergenic
1065667871 10:28082456-28082478 AAGAAGGAGGAGGAGGAGGAAGG - Intronic
1065767588 10:29045507-29045529 AAGAAGGATTAGGAAGAAGAAGG + Intergenic
1066466273 10:35653110-35653132 AAGAGTGACCAGAATGAGGATGG + Intergenic
1066609345 10:37222656-37222678 ATGGAGGAACAGCATGAGGAAGG - Intronic
1067349378 10:45462240-45462262 GAGAAAGGTCAGAATGAGGAGGG + Intronic
1067847177 10:49733800-49733822 AAGAACGATCAGCGTGAGGTTGG - Intergenic
1069588872 10:69630023-69630045 AAGAAGGAGAAGAAGGAGGAGGG - Intergenic
1069900630 10:71704880-71704902 AAGGAGGGGCAGCATGAGGGTGG - Intronic
1069991357 10:72318544-72318566 CAGAAGGAACAGCATGAGTGAGG + Intergenic
1070191227 10:74113668-74113690 AACAAGGGTAAGCATGAAGAGGG + Intronic
1070332592 10:75429083-75429105 TAGAAGGAACAGAAGGAGGAAGG - Intergenic
1070385633 10:75921836-75921858 AGGAAGGATCAGAAGGAGGAAGG - Intronic
1071262368 10:83932362-83932384 GAGAAAGATCAGCATCAGAAAGG + Intergenic
1073057662 10:100712744-100712766 AAGAAGGATGAGCGAGAGGAGGG - Intergenic
1073330841 10:102669066-102669088 AAGAAGAAAAAGCAGGAGGAAGG - Intergenic
1073767029 10:106694095-106694117 AGGAAGGATAAACATGAGGCCGG + Intronic
1075301719 10:121330659-121330681 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1075914337 10:126154524-126154546 AAAAAGGATGAGCTTGAGGCAGG - Intronic
1075947813 10:126453456-126453478 AAGAAGGATGGGAATCAGGACGG + Intronic
1076239053 10:128888783-128888805 AAGAAGGATGAGAATGAGGCAGG + Intergenic
1079110515 11:17602660-17602682 GAGGAGGAGGAGCATGAGGAGGG - Intronic
1079623940 11:22592851-22592873 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1079810238 11:24989609-24989631 AAGAAATGTCAGCATCAGGATGG - Intronic
1081700585 11:45150138-45150160 CAGAAGGAACAGCATGAGGAAGG - Intronic
1082294270 11:50418956-50418978 AAGAAGGATAAGGATGATGATGG + Intergenic
1082921979 11:58505409-58505431 AAGGAGGAGCAGGATGAGGAGGG + Intergenic
1083865007 11:65448938-65448960 AAGAGGTGTCAGCAGGAGGAGGG - Intergenic
1084380674 11:68810562-68810584 GAGAAGGAACAGGATGTGGAGGG + Intronic
1085471686 11:76762607-76762629 AAGAAGTGACTGCATGAGGAGGG - Intergenic
1085558568 11:77448744-77448766 AAATAAGATTAGCATGAGGAAGG + Intronic
1086825525 11:91490363-91490385 AGGAAGGAGCAGAAAGAGGAAGG - Intergenic
1087015096 11:93546932-93546954 TGGAAGGAACAGCATGTGGAAGG - Intergenic
1088075758 11:105846729-105846751 AAGAAGGATCATCCTAATGATGG + Intronic
1089360852 11:117885559-117885581 GAGAGGGATCAGAATGGGGATGG + Intergenic
1091064336 11:132494551-132494573 AAGATGGTTCTGCATGAAGAAGG + Intronic
1091716165 12:2777645-2777667 TAGAGGGAACAGCATGAGCATGG - Intergenic
1091882044 12:3987513-3987535 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1092964621 12:13629633-13629655 GAGAAGGAGGAGCAAGAGGAGGG - Intronic
1093602524 12:21046279-21046301 AAGAAGGATAAGGAGGAGGAGGG - Intronic
1093832223 12:23776382-23776404 AAGAAGGATATGACTGAGGAAGG + Intronic
1094232411 12:28122324-28122346 AAGAAGCAGAAGAATGAGGAGGG + Intergenic
1094292453 12:28867264-28867286 AACAAGGATAAGGATGTGGAAGG - Intergenic
1094619332 12:32065229-32065251 AAGAATGCTCAGCAAGAGGCTGG - Intergenic
1094782690 12:33810845-33810867 AACAAGGATAAGCATGAAGAAGG - Intergenic
1095601863 12:44022610-44022632 AAGAAGGATGATGTTGAGGAGGG + Intronic
1096017952 12:48295672-48295694 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096120504 12:49086240-49086262 CAGAAGGAACATCATGAGCAAGG - Intergenic
1096575666 12:52551334-52551356 AAGAAAGATGAACATGAGGAGGG - Intronic
1096814857 12:54195703-54195725 AAGAAAGAGAAGGATGAGGAAGG - Intergenic
1096900718 12:54878131-54878153 ATGAGGGATCAGCATGGGGCTGG + Intergenic
1097874481 12:64630859-64630881 AAGAAAGATCAGGTTTAGGAGGG + Intronic
1098066467 12:66622781-66622803 TAGAAGGATGAGTATGAGTAAGG - Intronic
1098414970 12:70223072-70223094 AAGAAGCAGAAGCAGGAGGAAGG - Intergenic
1098622072 12:72613758-72613780 GAGAAGGAGCAGAAGGAGGAGGG + Intronic
1099680017 12:85815041-85815063 AACAAAGATCAGAATTAGGAAGG + Intronic
1100260166 12:92925761-92925783 AAAAAGGAGGAGCAGGAGGAGGG + Intronic
1100365322 12:93915176-93915198 GAGAGGGCTCAGGATGAGGAAGG + Intergenic
1100677650 12:96885816-96885838 AAGAAGGAAGAGGAGGAGGAGGG - Intergenic
1100850149 12:98701795-98701817 AAGAAAGAACAGGAGGAGGAAGG - Intronic
1101221825 12:102649615-102649637 AAGAAATATGAGAATGAGGATGG + Intergenic
1101229990 12:102731038-102731060 AAGACGGATCAGGAACAGGATGG - Intergenic
1101234323 12:102773311-102773333 AAGAAGGAACAAGATGGGGAAGG - Intergenic
1101586718 12:106091497-106091519 TAGAAGGGTCAGCATGAGGAAGG + Intronic
1101800929 12:108021499-108021521 ATGAAGGAGCAGGAGGAGGAAGG - Intergenic
1101923599 12:108953042-108953064 AAGAAAGAAAAGAATGAGGAAGG + Intronic
1102506774 12:113388927-113388949 AGGAAGGAGAAGCACGAGGAAGG - Exonic
1102899329 12:116624143-116624165 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1104081630 12:125434886-125434908 AAGAAGTTTCAGCATGAGGAGGG - Intronic
1107063716 13:36189086-36189108 AGGAAGAATCAGCATGAGCATGG - Intronic
1107117608 13:36763685-36763707 CAGAAGGATGGGGATGAGGAAGG + Intergenic
1107618018 13:42192558-42192580 AAGAAGGAGGAGGAGGAGGAAGG - Intronic
1108056789 13:46493407-46493429 AACAAGTATCAGGAAGAGGATGG - Intergenic
1108605410 13:52032503-52032525 AAGATGAATCAGCCTGTGGATGG - Exonic
1110569209 13:76986623-76986645 AAGAAGGACAAGGATGATGATGG + Intergenic
1111362787 13:87197081-87197103 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1114038128 14:18648832-18648854 AAGAAGGAGAAGGAGGAGGAGGG - Intergenic
1114120485 14:19666204-19666226 AAGAAGGAGAAGGAGGAGGAGGG + Intergenic
1114201219 14:20522569-20522591 AAGAAGGAGAAGGAGGAGGAGGG + Intergenic
1114690259 14:24574376-24574398 GGGCAGGGTCAGCATGAGGAGGG - Exonic
1114890983 14:26922749-26922771 AGAAAGGAACAGCATGAGGAAGG + Intergenic
1118766759 14:68915240-68915262 AAGAAGGAGCAGGGGGAGGAGGG - Intronic
1119575941 14:75722237-75722259 AAAAAAGAACAGCATGAGGGAGG - Intronic
1119996840 14:79262480-79262502 GAGAAGGAGGAGAATGAGGAAGG + Intronic
1120034517 14:79681235-79681257 ATGAAGGCTCAGCAGGAGGAGGG - Intronic
1120180371 14:81336875-81336897 ATGAGTGATCAGCAGGAGGAGGG + Intronic
1121307644 14:92917148-92917170 AAGAGGGATCAGCATGCCGCTGG + Intergenic
1121664263 14:95660045-95660067 CAGCAGGATCAGAGTGAGGAAGG - Intergenic
1121735707 14:96216675-96216697 AAGAAGGAGGAGGAGGAGGAAGG + Intronic
1122739906 14:103866288-103866310 AAGAAGGAACAGCTTTAGCAGGG + Intergenic
1124822774 15:33063837-33063859 AAGAATGAACAGCATAAGGGTGG - Intronic
1125916657 15:43493542-43493564 AAGAAGAAGCGGCTTGAGGATGG + Intronic
1126532096 15:49721788-49721810 GAGAAGGAACAGTATGAGAAGGG - Intergenic
1126860698 15:52879958-52879980 AAGAGGGACCAGCAGGAGGATGG - Intergenic
1126957945 15:53955768-53955790 AAGAGGCATCAGAATGGGGAAGG - Intergenic
1127112046 15:55684801-55684823 ATGAAGGAACAGGATGAGAAAGG + Intronic
1127232114 15:57008063-57008085 AAGAGGCAAAAGCATGAGGATGG - Intronic
1127808315 15:62541352-62541374 AAGAAATAACAGAATGAGGAAGG - Intronic
1128157579 15:65401569-65401591 CAGAAGGAACAGGATGGGGACGG + Intronic
1129638676 15:77351376-77351398 AAGTATGATCAGAATGAGGCAGG + Intronic
1130905070 15:88234503-88234525 AGGAGGGAGCAGCGTGAGGAGGG - Intronic
1131102725 15:89705941-89705963 CAGAAGGAACAGCATGGGCAAGG - Intronic
1131851692 15:96550451-96550473 AAGCAGGTTCAGCAGGAGGTGGG + Intergenic
1131901123 15:97088728-97088750 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1132032520 15:98450322-98450344 TAGAAGGAGCAGCATGAGCCAGG + Intronic
1132053776 15:98633961-98633983 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1132769131 16:1551318-1551340 CCGAAGGATCAGCAGCAGGAGGG + Intronic
1133661391 16:7921359-7921381 AGGAAGGATCAGCTTGAGAATGG + Intergenic
1134293595 16:12924200-12924222 AAGAAAGGTGTGCATGAGGAGGG + Intronic
1134441362 16:14301573-14301595 AAGTAGGAGCAGCATCAGGCAGG - Intergenic
1134748052 16:16602967-16602989 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1135295730 16:21278009-21278031 AAGGAGGAGCAGGAAGAGGAGGG - Intronic
1135565486 16:23508499-23508521 AAGATGGAGGAGAATGAGGAAGG - Intronic
1136070048 16:27782252-27782274 AGGAAGCCTCAGCATGTGGAGGG - Intergenic
1137386497 16:48047474-48047496 AAGGAGGAGAAGCAGGAGGAGGG + Intergenic
1137557136 16:49477603-49477625 AAGAAGGAAGAGGAGGAGGAGGG + Intergenic
1138293872 16:55870396-55870418 AAGAAGGAAGAGAAAGAGGAAGG + Intronic
1138992252 16:62405401-62405423 AAGACAGATCAGCATGAGAAAGG - Intergenic
1140188578 16:72795606-72795628 TACAAGGATGAGGATGAGGAGGG - Exonic
1140459452 16:75127400-75127422 AAAAAGCATGAGCATGAAGAGGG + Intergenic
1140590716 16:76349018-76349040 GAGAAGGATCAGCACAAGCAAGG + Intronic
1141302691 16:82832446-82832468 AAGGAGGATGAGAAGGAGGAAGG - Intronic
1141952401 16:87347395-87347417 AAGATGTATCAGAATGAGGCCGG + Intronic
1142153159 16:88521545-88521567 GAGAGGGAACAGCATGAGGGAGG - Intronic
1142153200 16:88521686-88521708 GAGAGGGAACAGCATGAGGGAGG - Intronic
1143307758 17:5961105-5961127 AAGAAGGATTTGGGTGAGGAAGG - Intronic
1144752977 17:17662843-17662865 GAGAAGGAACAGCAGGAGGAGGG - Intergenic
1145839860 17:27985208-27985230 AGGAAGGATCAGTGTGAGGAGGG + Intergenic
1146234877 17:31149792-31149814 ATGAAGGAGGAGCTTGAGGAGGG + Intronic
1148458677 17:47825030-47825052 AAAAAGAATCAGGATGAGGTTGG + Intronic
1148541277 17:48482584-48482606 AAAAAGGATGTGCATGAGGTAGG + Intergenic
1148986791 17:51629300-51629322 GAGAAGGAGAAGCATGAGCAAGG - Intergenic
1150162095 17:62907137-62907159 TAGAAGGAACAGCAGGAGAAAGG + Intergenic
1151158791 17:72147189-72147211 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1151467481 17:74296758-74296780 AAGAGGGAGCAGAATGAGGCTGG - Intronic
1152011459 17:77721335-77721357 AAGGAGGATCAGCCAGATGAAGG + Intergenic
1152474714 17:80510478-80510500 AAGTGGGGTGAGCATGAGGAAGG - Intergenic
1152490840 17:80632298-80632320 CACAGGGATCCGCATGAGGAAGG - Intronic
1153056987 18:955645-955667 AAGACAGCTCAGCAGGAGGATGG + Intergenic
1153599106 18:6761611-6761633 ACCAAGGATCAGAATCAGGAAGG + Intronic
1154099975 18:11463890-11463912 CAGAAGAATGAGTATGAGGAAGG - Intergenic
1155858364 18:30864252-30864274 AAGAAGGATGAGGAGAAGGACGG + Intergenic
1155974492 18:32113784-32113806 AAGAAGTATCAGGATGAATATGG + Exonic
1156126313 18:33909801-33909823 AGGAAGGATAGGCAAGAGGAAGG + Intronic
1156173192 18:34511138-34511160 TACTAGGATCAGCATGAGTAAGG + Intronic
1157673289 18:49548995-49549017 TAAAAAGATCAGAATGAGGAGGG + Intergenic
1157768665 18:50325138-50325160 AAGAAGGAGAAGGAGGAGGAAGG - Intergenic
1157933502 18:51849006-51849028 AAGAATTATAAACATGAGGAGGG - Intergenic
1158813014 18:61059198-61059220 AAAAAGGATGAGCGTGAGAATGG - Intergenic
1159198706 18:65153785-65153807 AAGAAGGAGGAGGAGGAGGATGG - Intergenic
1159757947 18:72389430-72389452 AAGAAGGATCAGCAGGATATAGG - Intergenic
1159890043 18:73944216-73944238 AAGAAGGAACAGCATGACAACGG - Intergenic
1161788856 19:6346464-6346486 AAGAAGGAGGAGGAAGAGGAGGG - Intergenic
1161989039 19:7673507-7673529 GAGAAGGATGAGGAGGAGGAAGG - Intergenic
1162201252 19:9022178-9022200 AAGAAGGAGGAGGACGAGGAAGG - Intergenic
1162589442 19:11581260-11581282 AAGCAGGATTGGCAGGAGGAAGG - Intronic
1164399700 19:27894126-27894148 TAGAAGGAACAGAATGTGGAAGG - Intergenic
1165690887 19:37862382-37862404 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1167104573 19:47422389-47422411 AAGGAGGATGAGGAGGAGGACGG - Intergenic
1167139215 19:47638113-47638135 AAGAAAGAGCAGGAGGAGGAGGG - Intronic
1167795030 19:51703446-51703468 CACAAGCATCAGCAAGAGGAGGG + Intergenic
1168209039 19:54875668-54875690 AAATAGAATCAGCATAAGGAAGG - Intronic
1168326981 19:55543474-55543496 AAGAAGGAAGGGGATGAGGAAGG - Intronic
1168724333 19:58572552-58572574 CAGAAGGAACAGCGCGAGGAGGG - Intronic
926069638 2:9876103-9876125 AAGAAGGCTTAACTTGAGGAAGG + Intronic
930232120 2:48853856-48853878 AAGAAGGATAAGAATTAGGCAGG - Intergenic
930510254 2:52335492-52335514 AAGAAGGAGCAGAAGCAGGAAGG - Intergenic
931011399 2:57918835-57918857 AAGAAGGATCAGGATTAGACTGG - Intronic
931965162 2:67524760-67524782 AAGAGGGAACATCATGAGGTAGG - Intergenic
932088148 2:68780692-68780714 AAGAAGGAAGAGGAGGAGGAGGG - Intronic
932573452 2:72950360-72950382 AACCAGGATCAGCATGAGGTGGG - Intronic
932989946 2:76774608-76774630 AAGGAGGAGGAACATGAGGAAGG + Intronic
933197385 2:79407605-79407627 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
934064220 2:88325052-88325074 AAGCAGAATCAACATGAGAAAGG + Intergenic
934742422 2:96734447-96734469 AAGAAGAATCTGCATGGGGATGG - Exonic
935100719 2:99992990-99993012 AAGAAGGAACAGAAAGGGGAGGG - Intronic
935711858 2:105906091-105906113 GAGAAGGAGCAGCATGAGAAAGG - Intergenic
936891392 2:117373922-117373944 AAGAAAAACCACCATGAGGAGGG + Intergenic
936927727 2:117754878-117754900 AAGAAGGTTTAGAAGGAGGAAGG - Intergenic
937278699 2:120702841-120702863 AGGAAGGAGCAGAATGAGGTCGG - Intergenic
937649139 2:124300393-124300415 AGGAAGGATCTGCTGGAGGAAGG + Intronic
938161931 2:128993665-128993687 AAGGTGGATGAGGATGAGGAAGG + Intergenic
938842792 2:135179259-135179281 AAGAAAGAACAGAATGAGGCTGG + Intronic
938846842 2:135218573-135218595 AAGAAGGGTCATCATGCGCAGGG - Intronic
939335407 2:140820889-140820911 AAGAAGCAACAGAAAGAGGAGGG - Intronic
940165347 2:150764569-150764591 AGGAAGGATCAGCTTGTGTAGGG - Intergenic
941350305 2:164424348-164424370 AAGAAGGAACAGAGGGAGGAAGG + Intergenic
943707995 2:191056370-191056392 AAGAAGCAACAGGATGAGGCTGG + Intronic
943789917 2:191920862-191920884 ATGATGGATAAGGATGAGGAAGG + Intergenic
943868965 2:192967843-192967865 AAGAATGGTAAGCATGATGATGG + Intergenic
944205448 2:197153283-197153305 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
945786781 2:214249399-214249421 AAGAAGGAGAAGGAAGAGGAGGG + Intronic
946311037 2:218882801-218882823 ACCCAGAATCAGCATGAGGAGGG + Intronic
946542544 2:220700790-220700812 AAGCAGGAAGAGCAGGAGGAAGG - Intergenic
946605344 2:221398570-221398592 GAGAAGGATGAGCATCAGGGAGG + Intergenic
947189961 2:227493826-227493848 AAGAAGTATCAGCAGTAGTATGG + Intronic
947375362 2:229489812-229489834 CAGCAGGATAAGGATGAGGAAGG + Intronic
947708226 2:232293493-232293515 AAGCAGGTGGAGCATGAGGAAGG + Intronic
947955725 2:234189185-234189207 AAGAGGCAGCAGCAAGAGGATGG + Intergenic
948422298 2:237867313-237867335 AAGAAGGAGGAGCAAGAGGAGGG + Intronic
1169954354 20:11084682-11084704 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1170089891 20:12579300-12579322 TAGAAAAATCAGGATGAGGAAGG - Intergenic
1170457192 20:16544243-16544265 CAGAAGGACCAGCATGAGCAAGG - Intronic
1172043035 20:32059460-32059482 AAGAAGGAGGAGGAGGAGGAAGG - Intronic
1172228772 20:33323158-33323180 AAGAAGGGGCAGGAGGAGGAAGG + Intergenic
1172305911 20:33880590-33880612 AGGAAGGATGAGCATGCGCAAGG + Intergenic
1172382193 20:34504242-34504264 AACAAGCATCAGCATCATGAGGG - Intronic
1172847843 20:37940427-37940449 GGGAAGGCTCAGCATGAGGGAGG + Intronic
1172956983 20:38767916-38767938 CAGAAGGACTAGCATGAGCAAGG + Intronic
1173040567 20:39458570-39458592 AAGGAGGAGCAGCATGAGAGGGG + Intergenic
1173112278 20:40203205-40203227 CAGAAGGAAAAGCAAGAGGAGGG + Intergenic
1173476819 20:43365528-43365550 AAGAAGGATGGGGATGAGGATGG - Intergenic
1173646880 20:44638921-44638943 CAGAAGGAACAGCATGTGCAAGG + Intronic
1174686733 20:52463621-52463643 AAGAAGGATCAGGCTGAGTTGGG + Intergenic
1175589160 20:60173454-60173476 AAGAATGATGAGGATGAGGGGGG + Intergenic
1175709579 20:61208547-61208569 AAAAAAGATGAGGATGAGGATGG + Intergenic
1176069953 20:63221029-63221051 AAGACGGCTCAGCACGTGGAAGG + Intergenic
1176694661 21:9959740-9959762 GAGAAGTAGCAGCATGGGGACGG - Intergenic
1177607175 21:23395786-23395808 AAGAAGGATGTGCATCAGAAAGG + Intergenic
1178161147 21:29916401-29916423 AAGAAGCAGCAGCATTAGTAAGG + Intronic
1178243104 21:30925323-30925345 AAGAAGGATGAGGAAGAGAAAGG - Intergenic
1178692726 21:34763127-34763149 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1178775332 21:35544774-35544796 AGGGAGGATCAGCAAGAGGCAGG - Intronic
1179219146 21:39390823-39390845 AAGAAAGATCAACAAGATGACGG + Exonic
1181913778 22:26262719-26262741 AAGGAGGACCAGCATGTGCATGG + Intronic
1181931335 22:26403936-26403958 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1182099525 22:27648162-27648184 AAGAAGGAGAAGAAGGAGGAGGG + Intergenic
1182127884 22:27829393-27829415 CTGAGGGAACAGCATGAGGAAGG + Intergenic
1182561908 22:31166606-31166628 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
1182923244 22:34099341-34099363 AGGATGGATGAACATGAGGATGG - Intergenic
1184653640 22:45930638-45930660 AGGCAGGAGCAGCCTGAGGAAGG - Intronic
1185404942 22:50642404-50642426 AAGAAGCCTCTGCATGGGGAGGG + Intergenic
949177213 3:1079579-1079601 AGGATAGCTCAGCATGAGGAGGG + Intergenic
949250100 3:1973200-1973222 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
949828812 3:8191807-8191829 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
950179482 3:10901176-10901198 GAGAAGGATAAGCCTGAGCAAGG - Intronic
950576034 3:13832556-13832578 AAGATGGATCGACATGGGGAGGG - Intronic
951242086 3:20298542-20298564 AAGAAGGATGAGGAAGAAGAGGG - Intergenic
951704180 3:25527173-25527195 CAGAAGGATCAGCACGATGTAGG - Intronic
952013938 3:28934428-28934450 AAGAAGGAACAGTAAGAGGGAGG + Intergenic
952309324 3:32173294-32173316 AAGAAGGATGAGGCTGAGCATGG - Intergenic
953090329 3:39718481-39718503 TATAAGGATCAGAATGAGAATGG + Intergenic
955087826 3:55720104-55720126 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
956212623 3:66817301-66817323 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
957304169 3:78435037-78435059 AAGAAGAATCATAATGATGATGG + Intergenic
957335501 3:78822689-78822711 AAGTTGGACCAGAATGAGGAAGG - Intronic
957573289 3:81976712-81976734 AAGAAGGAGGAGAAAGAGGAGGG + Intergenic
958804956 3:98799408-98799430 AAGAAGTATCAGGAGCAGGAAGG - Exonic
960255969 3:115512025-115512047 AAGAAGAATGAGGATGAGAAGGG + Intergenic
960266384 3:115625140-115625162 GAGAAGGAGCAGGAAGAGGATGG + Intronic
960974951 3:123164440-123164462 GGGAGGGAGCAGCATGAGGAAGG - Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
963043393 3:141085120-141085142 TAGAAGGAATAGCATGTGGAAGG + Intronic
963973932 3:151460086-151460108 AGGAAGGAACAGCAGGATGAAGG + Intergenic
964304423 3:155325478-155325500 AATAAGGATGAGGATGAAGATGG - Intergenic
964445442 3:156752780-156752802 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
964564344 3:158033209-158033231 AAGAAGGAGAAGGAGGAGGAGGG + Intergenic
964568135 3:158080875-158080897 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
965263068 3:166507705-166507727 AAGAAGCATAAGCTTGAGCATGG - Intergenic
965467768 3:169053693-169053715 AAGAGGGATCAATATAAGGAAGG - Intergenic
965899126 3:173617068-173617090 TAGAAGGATCAGCATGTGCAAGG - Intronic
966104454 3:176319530-176319552 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
966158715 3:176945936-176945958 AAGATGAAACAGAATGAGGAAGG + Intergenic
966615754 3:181910917-181910939 AGGAAGGCTCAGCATAAGTAGGG - Intergenic
967319134 3:188178279-188178301 AAAGAGGAGAAGCATGAGGAGGG - Intronic
970435961 4:16035890-16035912 TAGAAGGATAAACATGAGAAAGG + Intronic
971259447 4:25043111-25043133 GAGAAGGAACAGGCTGAGGATGG + Intergenic
971479097 4:27098688-27098710 AAGAATGACAAGGATGAGGATGG - Intergenic
971831242 4:31698631-31698653 AAGAAGTATCAGAATTATGAAGG - Intergenic
971940749 4:33212334-33212356 AAGAAAGATCTTCATGAAGAGGG + Intergenic
972155127 4:36151426-36151448 AAGAAGGATCAGAATCTGCACGG + Intronic
973014367 4:45119042-45119064 CAGGAGGAACAGCATGAGGGAGG + Intergenic
973996225 4:56462124-56462146 ATGAAGAATCAAAATGAGGACGG + Intergenic
974112201 4:57538051-57538073 GAGGAGGATCAGGAGGAGGAGGG - Intergenic
974235511 4:59176230-59176252 GAGAAGGATGAGTAAGAGGAGGG - Intergenic
976818160 4:89174511-89174533 AAGAAGGGGCAGAGTGAGGATGG - Intergenic
977028314 4:91849183-91849205 AAGAAGCACCAGCATGGGAATGG - Intergenic
977415484 4:96727548-96727570 AAGAAGGAAGAGTAAGAGGAGGG + Intergenic
977731095 4:100352919-100352941 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
978167457 4:105625879-105625901 AAGAAGGATCAGCATGAGGAAGG - Intronic
978485306 4:109247065-109247087 AAGAAAGATAAGCTTGAGGCTGG + Intronic
978556847 4:109990226-109990248 GAGAAATATCAGGATGAGGAAGG + Intronic
978682765 4:111402368-111402390 GAGAAGGAGCAGGAAGAGGAGGG + Intergenic
979020122 4:115487115-115487137 AAGAAAGACCAACATGAAGATGG + Intergenic
980215403 4:129846275-129846297 TAGAAGGAACGGCATGTGGAGGG - Intergenic
980367287 4:131819965-131819987 GAGAAGTAGCAGCATGGGGATGG - Intergenic
981045727 4:140263379-140263401 AAGAAGGGTGAGCATGAGGCCGG + Intronic
981215739 4:142164892-142164914 AAGAAAGAGAAGCATTAGGATGG - Intronic
981455126 4:144944846-144944868 ATGGAGGATCATCATGAGGCAGG - Intergenic
981978924 4:150768270-150768292 TAGAGGAATCAACATGAGGAAGG + Intronic
982284820 4:153724133-153724155 GAGAAGGAAAAGGATGAGGATGG + Intronic
982416581 4:155140405-155140427 AAGGAGGATGAGGAGGAGGAGGG - Intergenic
983912167 4:173252227-173252249 ATGAGGGATGAGGATGAGGAAGG - Intronic
984552732 4:181180333-181180355 TAGAAGGATCAGCATGAACAAGG - Intergenic
985957986 5:3278805-3278827 AAGAAGGAGAAGGAGGAGGAAGG - Intergenic
986614995 5:9606825-9606847 GAGAAGGATCAGCCTGAGGAAGG + Intergenic
987092651 5:14521849-14521871 CAGCAGGGTCAGCATGAGAAAGG + Intronic
988246449 5:28688741-28688763 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
988439880 5:31220845-31220867 AAGAGGGGTCAGCATGGGTAAGG + Intronic
988998641 5:36738595-36738617 CAGAAGGAACAGAATGAGCAAGG - Intergenic
989483726 5:41963725-41963747 AAGGAGGAGCAGGAAGAGGAAGG + Intergenic
989634626 5:43521054-43521076 GAGGAGGAACAGCATGAAGATGG + Intergenic
989797215 5:45490472-45490494 AAGAATGCTCAGAAAGAGGAAGG - Intronic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990494942 5:56338023-56338045 GAGAAGGAGCAGGAGGAGGAGGG - Intergenic
990526482 5:56633167-56633189 AAAAAGGAGGAGCAGGAGGAGGG + Intergenic
990759779 5:59115636-59115658 AACATAGATCAGCATAAGGAAGG - Intronic
990960773 5:61391447-61391469 AAGAAATGTCAGGATGAGGATGG - Intronic
992004465 5:72463706-72463728 AGAAAGGACCAGCAGGAGGATGG + Intronic
992090644 5:73312955-73312977 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
992380114 5:76228469-76228491 AGGAAGGCTCAGCAGGAGGGTGG + Intronic
992836531 5:80647318-80647340 AAGAAAGAACAGCATGAAGATGG + Intronic
993558490 5:89372672-89372694 AAGAAGGAGAAGGAGGAGGAGGG - Intergenic
996202058 5:120687544-120687566 AAGAATGCTGAGTATGAGGAGGG - Intergenic
996624434 5:125553017-125553039 AAGAAGGAGCAGCTAGAAGAGGG - Intergenic
997051183 5:130382510-130382532 AAGAAGGATCAGATGCAGGAAGG + Intergenic
997128952 5:131257391-131257413 AAGAAAGTTCATCATGAGGCCGG - Intronic
997509946 5:134447186-134447208 AAGAAAGAACAGGAGGAGGAGGG + Intergenic
997884277 5:137616279-137616301 AAGCAGCTTCAGCAGGAGGAGGG + Intergenic
998554743 5:143112303-143112325 AATGGGGATCAGCATTAGGAAGG + Intronic
998933953 5:147214598-147214620 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
999813081 5:155146581-155146603 ACGAGGGAACAGCATGAGTAGGG - Intergenic
1000628726 5:163567774-163567796 AGGAAGGAAGAGAATGAGGAAGG - Intergenic
1001144880 5:169175141-169175163 AAGAAGGAACAAAATGAAGAAGG + Intronic
1001154387 5:169260422-169260444 AGGAAGGATCAGACCGAGGACGG + Intronic
1001903703 5:175453250-175453272 AAGAAGGAAGAGGAGGAGGAGGG + Intergenic
1002545412 5:179939915-179939937 AAGAAGGATTAGACAGAGGAAGG - Intronic
1003049614 6:2767307-2767329 GAGAAGAACCAGCATCAGGAAGG + Intronic
1003056766 6:2828043-2828065 AAGAAGAATTAGCAAGAGGATGG - Intergenic
1003189498 6:3861791-3861813 AAGAAGGAGCTGCATGTGTATGG + Intergenic
1003313407 6:4988428-4988450 AAAAAGGATCATCATGGTGATGG - Intergenic
1003722344 6:8718006-8718028 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1004119676 6:12808834-12808856 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
1004334271 6:14750070-14750092 GAGCAGGAAGAGCATGAGGAAGG - Intergenic
1005943383 6:30578112-30578134 AAGAAGGATGTGGATGATGATGG + Exonic
1006094073 6:31644900-31644922 GAGCAGGATCAGCATGATGAGGG - Intronic
1006391998 6:33764012-33764034 TAGAAGGTTCAGCAGGAAGATGG - Intergenic
1006925825 6:37654663-37654685 AAGACGGAGCAGGAAGAGGAGGG + Intronic
1007183406 6:39947196-39947218 AAGAAAGATGAACAGGAGGAGGG + Intergenic
1007813716 6:44505118-44505140 AAGGAAGGTCCGCATGAGGAGGG - Intergenic
1007817559 6:44535225-44535247 AGGAAGGATTAGCAGGAGGATGG + Intergenic
1007883890 6:45203706-45203728 CAGAAGGCTCTGCATGAGGCTGG - Intronic
1008069460 6:47084969-47084991 AATAAGGCTCAGCATGATGCGGG - Intergenic
1008202739 6:48612158-48612180 AAGAAGGAAAAGGAGGAGGAGGG - Intergenic
1009860665 6:69326840-69326862 AGGGAGGATAAGGATGAGGAGGG + Intronic
1009961464 6:70527764-70527786 AAGAAGGAGCAGAACGAAGAGGG - Intronic
1010255648 6:73754291-73754313 AAGAGGGCTCAGCATGGGAAAGG + Intronic
1010311404 6:74390030-74390052 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1010327692 6:74583998-74584020 AAAAATGATCAGAAGGAGGAAGG + Intergenic
1010333329 6:74650216-74650238 AAGAAGGAAGAGTATGGGGAAGG - Intergenic
1011053175 6:83176718-83176740 AAGAAAGATCAGCATTAGATTGG + Intronic
1011484792 6:87830139-87830161 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1011490296 6:87884582-87884604 ATGAAGGCTCAGGATGGGGAAGG + Intergenic
1011974965 6:93284436-93284458 AAGAAAGATCAGCAGCAGCAGGG + Intronic
1012493779 6:99811923-99811945 AAAATGTATCAGCAAGAGGAAGG - Intergenic
1013435184 6:110097617-110097639 GAGAAGGATCAGCATAACAAAGG + Intergenic
1014075223 6:117227685-117227707 AAGATGGATGATCATGAGGTAGG - Intergenic
1014561912 6:122901174-122901196 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1014999776 6:128200830-128200852 AAGAAGGATGAGGAGGAGGGGGG + Intronic
1016904310 6:149133753-149133775 ATGGAGGATGAGGATGAGGATGG - Intergenic
1017075681 6:150615632-150615654 GAGAAGAATCAGACTGAGGAGGG + Intronic
1017083025 6:150686714-150686736 AAGAAGGATGAGAATGTGGGCGG + Intronic
1018044249 6:159952062-159952084 AAGAAGGTTGGGCAGGAGGAGGG - Intergenic
1018204184 6:161421483-161421505 AAGCAGGACCAGCATGAGGGTGG + Intronic
1019648069 7:2141553-2141575 AAGAAGGCACCGCATGAGGGAGG + Intronic
1019865849 7:3709371-3709393 AAGTAGGAGCAGCAGAAGGAAGG - Intronic
1021352287 7:19609928-19609950 AAGAAGGAACAGAGGGAGGAAGG - Intergenic
1022691601 7:32661768-32661790 AATAAGGATAAGAATCAGGAAGG + Intergenic
1023168762 7:37369901-37369923 AAGGAGGATCAGAAGGAGTAGGG - Intronic
1023554091 7:41402019-41402041 AAAAAGGACCAGCATGTGTAGGG - Intergenic
1023758780 7:43444679-43444701 GAGAAGGAGCAGGAGGAGGAGGG + Exonic
1025003672 7:55339161-55339183 CAGAAGGAGTAGAATGAGGAAGG + Intergenic
1025871554 7:65439118-65439140 AAGAGGGAACAGTATGAAGAGGG - Intergenic
1026638631 7:72105766-72105788 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
1027810993 7:82898213-82898235 TAAAAGGATCAGCATGAAAAAGG + Intronic
1027903430 7:84148733-84148755 GAGGAGGATCAGGAAGAGGAGGG - Intronic
1028076202 7:86518640-86518662 AAGAAGGAGCTGCAAGAGGCTGG + Intergenic
1029287592 7:99476535-99476557 AAGAGGGCTCAGTCTGAGGAAGG - Intronic
1029473666 7:100770070-100770092 CAGATGGAAAAGCATGAGGAAGG + Intronic
1029584404 7:101461288-101461310 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
1030640043 7:111994461-111994483 AAGAAGGAACAGCATCAGAAGGG + Intronic
1031316274 7:120261388-120261410 AAGTAGGATGAGGACGAGGAAGG + Intergenic
1031762917 7:125737116-125737138 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1032470573 7:132175526-132175548 AAGTAGCATCACCTTGAGGAAGG - Intronic
1032948339 7:136877769-136877791 AAGAATCATCAGCATGACTAAGG - Intronic
1033114984 7:138617391-138617413 AAGAAGGAGGAGCAAGAAGAAGG + Intronic
1033204674 7:139408371-139408393 AAAAAGCAGCAGCATCAGGATGG + Intronic
1033331467 7:140420447-140420469 AAGAAGGAGCAGAAGGAGGCAGG + Intronic
1033832619 7:145271695-145271717 AAGAAGAATAAGCAGGAAGAAGG + Intergenic
1033952762 7:146805572-146805594 AGGAAGGAACAGCAAGAGGGAGG + Intronic
1036645623 8:10610156-10610178 AAGAAGGAACAGAAGGAGAAGGG - Exonic
1038839875 8:31174723-31174745 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1039854007 8:41397171-41397193 AAGAAGGAGCAGCAAGACGAAGG + Intergenic
1041003973 8:53481508-53481530 AAGGATGAGCAGCATGGGGATGG - Intergenic
1042702846 8:71635682-71635704 AAGAATGAACCGCCTGAGGATGG - Intergenic
1043444604 8:80306959-80306981 AAAAAGGATCAGGATGGGCATGG + Intergenic
1043445636 8:80316754-80316776 AAGAATCACCAGCATGAAGATGG - Intergenic
1044283595 8:90385132-90385154 CAGAAGGATCAGCTTGAGCAAGG - Intergenic
1044584374 8:93855961-93855983 AAGAATGATGAGGAAGAGGATGG - Intergenic
1044992803 8:97811553-97811575 AAGAATGATGAACCTGAGGAGGG + Intronic
1045708374 8:104954797-104954819 AAGAAGGATCATCTTCAAGATGG + Intronic
1046167620 8:110458189-110458211 AAGAAAAAGCAGCATGAAGAAGG + Intergenic
1047073646 8:121375983-121376005 AAGAAGGAGGAGTATGAGGGAGG - Intergenic
1047184752 8:122622803-122622825 AAAAAGGAACAGCATGAAGACGG - Intergenic
1047739519 8:127795249-127795271 AAGAAGAATGACCATGATGAGGG - Intergenic
1048259052 8:132930274-132930296 GTGAGGAATCAGCATGAGGATGG + Intronic
1048534754 8:135282929-135282951 AAGAAGGACTTCCATGAGGATGG + Intergenic
1048767402 8:137859932-137859954 AAGGAGGAGGAGCAGGAGGAGGG + Intergenic
1048862738 8:138736202-138736224 AAGCAGGATCAGCAAGCAGAAGG - Intronic
1049036448 8:140079966-140079988 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
1049515019 8:143049704-143049726 AAGGAGGAGGAGCATAAGGAGGG - Intronic
1050593923 9:7187071-7187093 AAAAATTATCAGTATGAGGAGGG + Intergenic
1050826167 9:9949477-9949499 AAGAAGTATCCACATGAAGATGG - Intronic
1050876306 9:10641049-10641071 GAGAAGGATCAGCGTGGGGTCGG - Intergenic
1052484317 9:29076499-29076521 CAGAAGGAACAGAATGAGTATGG + Intergenic
1053294186 9:36901262-36901284 CAGAAGGAACAGCATGATAAAGG - Intronic
1053631631 9:39945680-39945702 GAGAAGTAGCAGCATGGGGACGG - Intergenic
1053774131 9:41517850-41517872 GAGAAGTAGCAGCATGGGGACGG + Intergenic
1054212256 9:62305018-62305040 GAGAAGTAGCAGCATGGGGACGG + Intergenic
1054312729 9:63543814-63543836 GAGAAGTAGCAGCATGGGGACGG - Intergenic
1055153715 9:73035548-73035570 AAGAAGGAACATCTTGAGGGAGG + Intronic
1055584398 9:77742961-77742983 TAGAAAGATCAGCAGGAGGCTGG + Intronic
1056097211 9:83267287-83267309 ATGAGGGATCAGCATTGGGAGGG + Intronic
1056137932 9:83647540-83647562 AAGTGGGCTCAGCATGAGCAGGG - Intergenic
1056524058 9:87426348-87426370 AAGATGGATCATCACGAGGTTGG + Intergenic
1056860522 9:90176773-90176795 AAGAATCATTACCATGAGGATGG + Intergenic
1057181560 9:93033410-93033432 GAGAAGGAGCAGGAGGAGGAGGG - Intronic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058808935 9:108620286-108620308 AAGAAGGAAAAGGAGGAGGAGGG + Intergenic
1058921374 9:109618581-109618603 AAGAAGAAATACCATGAGGATGG - Intergenic
1059035680 9:110751392-110751414 GAGAAAGACCAGAATGAGGATGG + Intronic
1059174404 9:112155926-112155948 AAGAAGGAAGAGAAGGAGGAAGG + Intronic
1059525527 9:114987924-114987946 AAAAAGGCTAAGCATGAGAATGG + Intergenic
1059527055 9:115001850-115001872 ATTAAGGCTCAGCATGAGGTTGG + Intergenic
1059578590 9:115519183-115519205 AAGAAGGAGGAGGAAGAGGAGGG - Intergenic
1059592777 9:115679956-115679978 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1059740133 9:117141977-117141999 AAGCAGGATCAGGGTGAGGTTGG + Intronic
1059772300 9:117438813-117438835 AAATAGGAACAGCATCAGGAAGG + Intergenic
1060896686 9:127223437-127223459 GAGAAGGAGCAGGATGAGGCTGG + Intergenic
1060960507 9:127677427-127677449 AAGAGGGATCAAAATGAGAATGG + Intronic
1060989402 9:127839457-127839479 AAGAAGCAGCAGGAGGAGGAAGG + Intronic
1061084749 9:128392458-128392480 AAGAAGGACGAGGATGCGGATGG + Intergenic
1061608611 9:131730720-131730742 AAGAAGAACCAGCATTAGAAAGG + Intronic
1185887116 X:3792718-3792740 AAGAAGGAGCTGGAGGAGGAGGG + Intergenic
1186645430 X:11501838-11501860 GAGAAGGAGCAGGAAGAGGAGGG + Intronic
1186732075 X:12420569-12420591 ATGAAGGATCAGCATGTGTGAGG - Intronic
1186898333 X:14027608-14027630 AAGAAGGCATAGCATGGGGAAGG + Intronic
1187016772 X:15336488-15336510 ATCAAGGATCAGGGTGAGGAGGG - Intergenic
1188134199 X:26474229-26474251 AAGAGGGACCAGTATGAGGAGGG + Intergenic
1188202415 X:27307796-27307818 AAAAAGGAAAAGCATAAGGATGG - Intergenic
1188572402 X:31603817-31603839 AGGAAGGATCATCCTTAGGAGGG - Intronic
1189406943 X:40733746-40733768 AAGAAGGTTCTGCAGGAGGGAGG + Intronic
1193189105 X:78548572-78548594 AAGAAGGCACAGGAGGAGGAGGG - Intergenic
1194079404 X:89439932-89439954 AAGAAGGAAGAGAAGGAGGAGGG + Intergenic
1195609601 X:106851070-106851092 AAGATGGTTGAGCATTAGGAGGG - Intronic
1196344754 X:114641176-114641198 AACAAGGAGAAGCAGGAGGATGG - Intronic
1196760751 X:119198486-119198508 AAGAAGAATGAGAATGAGCAAGG + Intergenic
1197719973 X:129738593-129738615 AAAAAGGAGGAGGATGAGGAGGG + Intergenic
1197906098 X:131427352-131427374 GAGAAGGATGAGAAGGAGGAAGG - Intergenic
1198241977 X:134796389-134796411 AAGGAGGATGATGATGAGGAAGG + Intronic
1199008831 X:142734406-142734428 AACAAGCATCAGCATCATGATGG - Intergenic
1199109932 X:143919749-143919771 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1200432022 Y:3095237-3095259 AAGAAGGAAGAGAAGGAGGAGGG + Intergenic
1201461748 Y:14233042-14233064 AAGAAGAATGAGGAGGAGGAGGG - Intergenic