ID: 978167744

View in Genome Browser
Species Human (GRCh38)
Location 4:105629225-105629247
Sequence TGCTCAGCAAAGCTCTGAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978167742_978167744 -1 Left 978167742 4:105629203-105629225 CCAAGTGCATCACCTCATACAGT 0: 1
1: 0
2: 2
3: 8
4: 101
Right 978167744 4:105629225-105629247 TGCTCAGCAAAGCTCTGAATTGG 0: 1
1: 0
2: 1
3: 12
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978167744 Original CRISPR TGCTCAGCAAAGCTCTGAAT TGG Intronic
903296017 1:22343558-22343580 TGGTCAGCAAAGCCCTCACTGGG + Intergenic
904231777 1:29080039-29080061 TGCCCAAAAAAGCTGTGAATTGG - Intronic
908664969 1:66480278-66480300 TGCTCAGCGATGCTGTAAATCGG + Intergenic
913050402 1:115112592-115112614 CCCTCACCCAAGCTCTGAATAGG - Intergenic
913683880 1:121213467-121213489 TCCTCACCAAAGCACAGAATGGG - Intronic
914035719 1:144001082-144001104 TCCTCACCAAAGCACAGAATGGG - Intergenic
914153736 1:145066863-145066885 TCCTCACCAAAGCACAGAATGGG + Intronic
916482844 1:165230884-165230906 TGCTCAGCAGGACCCTGAATTGG - Intronic
920471184 1:206231959-206231981 TCCTCACCAAAGCACAGAATGGG - Intronic
924252032 1:242142555-242142577 TGCTAAGAAAAGGACTGAATGGG + Intronic
1065221455 10:23500169-23500191 TGCTCAGTAATACTTTGAATAGG + Intergenic
1066478111 10:35767788-35767810 TTGTCTCCAAAGCTCTGAATGGG + Intergenic
1068586308 10:58803182-58803204 TGCCCAGCAAAACTCCGAAAGGG + Exonic
1078968753 11:16379851-16379873 TGATCAGCTAAGCTATGAAATGG + Intronic
1080671459 11:34383205-34383227 TGCTCAGAAATGCTATGAACAGG - Intergenic
1083337671 11:61934631-61934653 TGCTCAGAAAAGACCTGAAGGGG + Intergenic
1086068676 11:82774582-82774604 TGCTAAGCAAAACTATTAATTGG + Intergenic
1087025947 11:93649956-93649978 TGCTCATCACTGCTCTGCATAGG - Intergenic
1090627562 11:128619660-128619682 TGCTCAGAAATGCTCGGACTTGG - Intergenic
1091495483 12:968742-968764 TGCCCAGCAAAGATCTGAGAAGG + Intronic
1092896594 12:13017637-13017659 TGCAAAGCAAAGCTCTGTTTTGG - Intergenic
1093003847 12:14031074-14031096 TGCTCACCTAAGCTCTAAAATGG - Intergenic
1097796179 12:63864579-63864601 GTCTCAGCAATGCTCTGAAATGG - Intronic
1099234193 12:80062797-80062819 TGCTCAGCAAAGCTCACCAATGG + Intergenic
1099643673 12:85322913-85322935 TGCTTAGCAACGTTCTGAAATGG + Intergenic
1099881461 12:88471977-88471999 TGCTCAGCAAAACTGCTAATTGG + Intergenic
1100299972 12:93297823-93297845 TGCTCTGCAAAGCTCTTGCTTGG - Intergenic
1101883934 12:108645286-108645308 TGCCCAGCCAAGCTCAGAGTAGG - Exonic
1106181622 13:27374294-27374316 TGCCCAGCAAAGTCCTGACTTGG + Intergenic
1106519457 13:30484123-30484145 CCCACAGCCAAGCTCTGAATGGG - Intronic
1106641323 13:31587213-31587235 TGCCCAGCAAAGCTGTGAGGGGG + Intergenic
1106661236 13:31801655-31801677 TGCTCTTCAAAGCTTTTAATAGG + Intronic
1110702439 13:78564575-78564597 GGCTGAACAAAGATCTGAATAGG + Intergenic
1113087055 13:106579627-106579649 TCCTCAGCAGAGCTATGATTTGG + Intergenic
1114669922 14:24404786-24404808 TGCCAAGCAAATCTCTGAGTGGG + Intronic
1114711962 14:24787718-24787740 TGCTTGGAAAAACTCTGAATGGG + Intergenic
1116949944 14:50870386-50870408 TGTTCAGGGAAGCTCTGGATGGG - Intronic
1117370020 14:55069577-55069599 TGCTCAGAGAAGCCCAGAATTGG - Exonic
1118000966 14:61523171-61523193 TGCACAGCAAATCTCTCAAGTGG - Intronic
1120353417 14:83394350-83394372 TGCTCAGGAAAGACCTGAAAAGG + Intergenic
1122269089 14:100560397-100560419 TGCTCAGCAAAGCCCTGCCCAGG + Intronic
1122699108 14:103575326-103575348 TACTCAGCAAAGCCATCAATAGG - Intronic
1123199274 14:106646512-106646534 TGTTCATCAATGCTCTCAATGGG - Intergenic
1126352205 15:47756016-47756038 TGATGAGGAAAGCTCTTAATGGG - Intronic
1127863135 15:63011165-63011187 GGCTTAGCAAAGGGCTGAATGGG + Intergenic
1128704106 15:69826058-69826080 TGCTCAGCAAAGCGGTGAGCAGG + Intergenic
1130355333 15:83124761-83124783 TGCTTACCAAACCTCTGAACAGG - Exonic
1130698910 15:86159212-86159234 TTCTCATCAAAACCCTGAATGGG + Intronic
1133257190 16:4524267-4524289 AGCACAGCACAGCTCTGTATGGG - Intronic
1133431777 16:5743385-5743407 TGCTCTGCAAAGGTCTCATTTGG - Intergenic
1135066412 16:19313985-19314007 TGCCCAGCAAAGCCCAGCATAGG - Intronic
1136624300 16:31452559-31452581 TGCTCAGCAAATTTCTGAATGGG + Intergenic
1141776266 16:86124556-86124578 TGCTAACCAAAGCACTGAACAGG + Intergenic
1147949197 17:44097579-44097601 TGCTCAGCAAGGCCCTGAGCTGG + Intronic
1156112435 18:33744571-33744593 TGCTCAGCAAAGTTATGACTGGG - Exonic
1156519597 18:37711041-37711063 TGATGATCAAAACTCTGAATTGG + Intergenic
1156710616 18:39940082-39940104 TCCTCAGCAAAGCTATGCTTGGG - Intergenic
1156838754 18:41586541-41586563 TGCCCAGCAAATCACTGAAAAGG + Intergenic
1164489307 19:28692196-28692218 TGCTGAGAAGAGCTCTGAAATGG - Intergenic
1166077748 19:40423523-40423545 TGCTGAGCAAGGGTCTGAAGCGG - Exonic
925195236 2:1917880-1917902 TTTTCAGAAAAGCGCTGAATTGG - Intronic
928085427 2:28343426-28343448 TGCTCAATAAAGCTCTCATTTGG - Intergenic
928180335 2:29064197-29064219 TTCTAAACAAAGCTCTCAATAGG + Exonic
929122738 2:38496859-38496881 TTCTCAGCAAAGCCCTTAATTGG + Intergenic
929290177 2:40181599-40181621 TGCACAGTAAAGCTATTAATAGG + Intronic
929548921 2:42876689-42876711 TGCACAGCACAGCTCTGGAGAGG - Intergenic
930300166 2:49605540-49605562 TGCTCATCAAATATCTGAATAGG + Intergenic
932693142 2:73930688-73930710 TGCTGAGCACAGCAGTGAATGGG + Intronic
933747811 2:85583722-85583744 GGCTCAGGAAGGCTCTGAAGTGG + Intergenic
933772194 2:85751689-85751711 TGCTCAGGAAACCTCTGATAAGG - Intronic
934556111 2:95287787-95287809 TGTTCAGCAAGGGTCTGCATCGG - Intronic
934733451 2:96673957-96673979 TGCCCAGAAAGGCTCAGAATGGG - Intergenic
934889612 2:98055888-98055910 TCCTCAGCAAGGCTATGATTAGG + Intergenic
937462553 2:122102020-122102042 TGCTCAGCTCAGATCTGAACTGG - Intergenic
937475712 2:122213454-122213476 TTCTCAGGAAACCTCTGAAAAGG - Intergenic
938708366 2:133953682-133953704 TGCTCTGCAGTGCTCCGAATGGG - Intergenic
940863610 2:158795249-158795271 TGCTCAGCAATGCCCTTAAGGGG + Intergenic
940961369 2:159790093-159790115 TGCTCAGCAAATGTCTGATATGG - Intronic
942132511 2:172894256-172894278 TCCTAAGCAGAGATCTGAATAGG - Intronic
942244384 2:173993511-173993533 TGCTCTGCACAACTCTGAGTGGG + Intergenic
943533617 2:189119176-189119198 TGCACAGCAAAGCTCTTCATTGG + Intronic
945335323 2:208585492-208585514 TGTTTAGAAAAGCTATGAATGGG + Intronic
948279753 2:236738007-236738029 TGCCCAGCAAAGCTATGCCTTGG + Intergenic
1168796163 20:611399-611421 GGCTCAGCAATTCTCTGAAGAGG - Intergenic
1169364292 20:4978728-4978750 GGCTCAGCACAGCTCAGAATAGG - Intronic
1175027560 20:55918739-55918761 GGCTCAGCAAAGGTCTGGCTTGG - Intergenic
1176048379 20:63104042-63104064 GGCTCAGCAAACCTCTTAAATGG - Intergenic
1178724141 21:35036334-35036356 TGCTCTGCAAACATCTTAATGGG - Intronic
1178923634 21:36757479-36757501 TGTTCAGCAGGGCCCTGAATCGG + Intronic
1179134086 21:38664387-38664409 AGCTCACCAAAGATGTGAATGGG - Intergenic
1179481354 21:41680745-41680767 TGCTCTGCGTAGCTCTGAAAGGG + Intergenic
1183703885 22:39465165-39465187 TGCTGAGAAATGCTCTGAACTGG + Intronic
1184671360 22:46013706-46013728 TGCTCAGCGCAGCTCTGGGTTGG + Intergenic
1185233285 22:49695341-49695363 TGCCCAGCAAAGCTCTCAGCTGG - Intergenic
953336102 3:42095233-42095255 TCCTCAGCACAGCTCTGAGGTGG + Intronic
955044813 3:55350026-55350048 TGTTCAGCAATGCACTGAATGGG + Intergenic
956708341 3:72018651-72018673 ATCACAGCAAAGCTCTGAAGGGG + Intergenic
956896703 3:73668079-73668101 TGCTCAGCAGAGCTCTCACTGGG - Intergenic
958844252 3:99246464-99246486 TACTCAGTAAAGCTGTGATTAGG + Intergenic
959906132 3:111712843-111712865 TTCACAGCAGAGCTCTGAATTGG + Intronic
961416763 3:126764838-126764860 AGTTTAGCAAAGCTCTGAAGTGG + Intronic
962690734 3:137895814-137895836 TCTTCAGCATAGCTCTGATTGGG - Intergenic
967215103 3:187203103-187203125 TGCTGAGAAAAGATCTGTATGGG - Intergenic
968118906 3:196110671-196110693 GCCTCAGCAAATCTCTCAATAGG - Intergenic
971473808 4:27053843-27053865 TGCTGAGCAGGGCTCAGAATGGG + Intergenic
974016499 4:56653826-56653848 TGCTATGCAGAGGTCTGAATTGG + Intronic
974421431 4:61681240-61681262 TGCTCAGAAATACTCTGAGTAGG - Intronic
977831327 4:101597119-101597141 TTCTCAGCAAAGCTTTGGCTTGG + Intronic
978146225 4:105375265-105375287 TGCACAGCAAAGCTGTTAAGGGG + Intronic
978167744 4:105629225-105629247 TGCTCAGCAAAGCTCTGAATTGG + Intronic
982128600 4:152206326-152206348 TTATCAGCAAAGTACTGAATCGG + Intergenic
982274668 4:153627114-153627136 TGCACAGGAAAGCTCTTCATGGG + Intronic
984278361 4:177637403-177637425 TGATCAGCCAAGGTCTGAAAGGG - Intergenic
986982543 5:13465911-13465933 TGCTCAGGAAACCTCAGAAAAGG + Intergenic
990509401 5:56476773-56476795 TGTTTAGCAAAGCTGTGAAATGG - Intronic
991653507 5:68880565-68880587 TGCTCAGCAGACCTCTGATCTGG + Intergenic
991976016 5:72184236-72184258 TGTGCAGGAGAGCTCTGAATGGG - Intronic
993373410 5:87119672-87119694 AACTAAGCAAAGCTCTCAATAGG + Intergenic
998193337 5:140044775-140044797 TCCTCAGCAAGGCTCTTCATGGG + Intergenic
1000127011 5:158255479-158255501 TGTTCAGCACAGCTCTACATTGG - Intergenic
1003172088 6:3727812-3727834 TGTGCGGCAGAGCTCTGAATGGG - Intronic
1004741369 6:18464409-18464431 TGCCCAGCAATGATCTGAATTGG - Intronic
1004857109 6:19762457-19762479 TTTTTAGCAAATCTCTGAATTGG - Intergenic
1006866615 6:37213820-37213842 TGCTCAGGAGTCCTCTGAATTGG - Intronic
1008885725 6:56430282-56430304 AGTTTAGCAAAGCTCTGAAGTGG + Intergenic
1012224360 6:96687880-96687902 TGCTGAGAAAGGCACTGAATAGG + Intergenic
1014374245 6:120652530-120652552 TGCTCAGCAAATATTTGAAAGGG - Intergenic
1016352776 6:143185477-143185499 TGATAAGCAGAGTTCTGAATGGG - Intronic
1016527599 6:145019960-145019982 TGGTCAGAAAAGACCTGAATTGG - Intergenic
1016974989 6:149798771-149798793 TGCACTGCAAAACTCTGAAAAGG + Intronic
1024946542 7:54813561-54813583 TGCACAGGACAGCTCTGAACTGG + Intergenic
1028640750 7:93039700-93039722 TGCTGAGGACAGCTCTGCATTGG + Intergenic
1031202257 7:118703150-118703172 TGTTCAGCAAATCTGTGAAAAGG + Intergenic
1032225917 7:130031716-130031738 TGCCCAGCAAAGACCTGAAAAGG + Intronic
1032235223 7:130115791-130115813 TTCTTAGTAAAGCTCTTAATAGG + Intronic
1034540486 7:151755076-151755098 CGCTCAGGACAGCTCTGAAGGGG - Intronic
1035528847 8:335682-335704 TGCTCTGCAGAGCTCTGCCTGGG - Intergenic
1039010489 8:33088044-33088066 TTCTCTGCCAATCTCTGAATCGG - Intergenic
1041140384 8:54811905-54811927 TCCTCACCAAAGCTCTGACTTGG + Intergenic
1041441889 8:57905941-57905963 TGGTCAGCAGAACTATGAATTGG + Intergenic
1041705510 8:60842622-60842644 TGCTCAGTAAATATCTGAATTGG + Intronic
1042351250 8:67779936-67779958 TGTTCATCAGAGCTCTGAGTTGG - Intergenic
1044188759 8:89288308-89288330 TGCTCAGCATATGTCAGAATTGG - Intergenic
1047277582 8:123417194-123417216 TGCTCAGCAGATCTCTGCTTCGG + Intronic
1047618827 8:126585856-126585878 AGCTCAGCAAGGCTGTGAGTTGG - Intergenic
1049875019 8:145011839-145011861 AGTTTAGCAAAGCTCTGAAGTGG - Intergenic
1050950028 9:11577752-11577774 TGGTGAGGAAAGCCCTGAATCGG + Intergenic
1052706274 9:31997201-31997223 AGCTAAGTAAAGCTCTGACTGGG + Intergenic
1055795354 9:79969623-79969645 TCCAGATCAAAGCTCTGAATTGG - Intergenic
1055886851 9:81073461-81073483 AGCTCTGCAAAGCCCTAAATTGG - Intergenic
1185571797 X:1140301-1140323 TGCTCGGCAAAGCTCAGCAAAGG - Intergenic
1186426270 X:9465801-9465823 TGCCCAGCAAGCCCCTGAATCGG - Intronic
1188185106 X:27103860-27103882 TGGTCAACACAACTCTGAATAGG + Intergenic
1189638333 X:43037599-43037621 TGCTCAGGAAAGATCTGAGAAGG - Intergenic
1189753202 X:44244173-44244195 TGCAGAGGAAAGCTCTAAATTGG - Intronic
1192695891 X:73415735-73415757 TCCTCAACAAGGCTCTGAATTGG + Intergenic
1196208808 X:112971809-112971831 TGTTCAGCACAGCTGGGAATAGG + Intergenic
1196349799 X:114714721-114714743 TGCTCTGAAATGCTGTGAATTGG - Intronic