ID: 978168035

View in Genome Browser
Species Human (GRCh38)
Location 4:105632303-105632325
Sequence TGCTGTGTCAAGCGTAGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 81}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978168034_978168035 6 Left 978168034 4:105632274-105632296 CCAAATCTTAAGCATTTATTTAG 0: 1
1: 0
2: 5
3: 46
4: 530
Right 978168035 4:105632303-105632325 TGCTGTGTCAAGCGTAGTTCTGG 0: 1
1: 0
2: 0
3: 1
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978168035 Original CRISPR TGCTGTGTCAAGCGTAGTTC TGG Intronic
905169591 1:36101453-36101475 TGCTGTGACAGGCATAGGTCAGG - Intronic
912571907 1:110630991-110631013 TGCTGTCTCAAGCACAGGTCTGG + Intronic
912806727 1:112762618-112762640 TGCTGTGCCAAGCTGACTTCCGG - Intergenic
917223354 1:172755638-172755660 AGCTGTGTCAAGGGTGTTTCTGG + Intergenic
923583581 1:235243119-235243141 TACTGTGCCAAGCATTGTTCAGG - Intronic
1070894265 10:79968689-79968711 GACTGTGTCAAAAGTAGTTCTGG + Intronic
1080055183 11:27899654-27899676 TGCTGGGTCAATGGTATTTCTGG - Intergenic
1082198155 11:49328233-49328255 TGCTGTGTTAAGAGTAGATGAGG + Intergenic
1086364023 11:86089848-86089870 TACTGTGTCCAGGGTAGATCTGG - Intergenic
1086657657 11:89379912-89379934 TGCTGTGTTAAGAGTAGATGAGG - Intronic
1087504695 11:99004331-99004353 TGCTGGGTCAATGGTATTTCTGG + Intergenic
1088894632 11:114068500-114068522 TGCAGTGTCAAGTGTAGTCATGG + Intronic
1092586470 12:9906103-9906125 TGCTGTGTCACACATAGTTTGGG + Intronic
1093663349 12:21783141-21783163 TGCTGGGTCAATGGTATTTCTGG + Intergenic
1096122672 12:49098242-49098264 AGCTGTCTCAAGAGCAGTTCGGG + Intronic
1098193106 12:67971549-67971571 TGCTGGGTCAATGGTATTTCTGG + Intergenic
1104715168 12:131011506-131011528 CACTGTGTCAGGCGTGGTTCCGG + Intronic
1107058966 13:36135059-36135081 TGCTGTGCCATGCCCAGTTCCGG - Intergenic
1112604935 13:100895127-100895149 TGCCTTATCAAGGGTAGTTCTGG - Intergenic
1115294866 14:31814061-31814083 TGCTGGGTCAATGGTATTTCTGG + Intronic
1125827194 15:42686528-42686550 TACTGTGACAAGCGTTCTTCTGG - Exonic
1130632012 15:85579130-85579152 TGATTTGTCAAGCATAGTTGAGG + Exonic
1134359048 16:13513451-13513473 TGCTGGGTCAATGGTATTTCTGG - Intergenic
1135928561 16:26717128-26717150 TGCTGGGTGAAGAGGAGTTCTGG + Intergenic
1150359951 17:64523202-64523224 TGTTGTGCCAGGCGCAGTTCTGG + Intronic
1152742917 17:82026219-82026241 TGCTGTGCCCAGCTCAGTTCTGG - Intronic
1152916659 17:83040493-83040515 TGCTGGGTCAAGCTGTGTTCAGG - Intronic
1159583505 18:70261343-70261365 TGCTGTGTCAATCAGAGTGCTGG + Intergenic
1163645382 19:18486216-18486238 TTCTGTGTGAAGCTTAGCTCAGG + Intronic
1164748757 19:30635726-30635748 GGCTGTGTAAAGAGGAGTTCCGG + Intronic
1165677836 19:37743602-37743624 TGCTGGGTCAAATGTATTTCTGG - Intronic
1166826032 19:45609758-45609780 TGCTGTGTCCACCGTACTTGTGG + Exonic
1168343985 19:55641588-55641610 TGCTGTGGGAAGCGGAGTCCCGG + Intronic
924975026 2:164952-164974 TGCTGGGTCAAATGTATTTCTGG - Intergenic
925426115 2:3750088-3750110 TGCAGTGTCCAGCGTGGATCCGG - Intronic
926387279 2:12349031-12349053 TTCTGTGTCCAGCTTATTTCAGG - Intergenic
936469399 2:112785429-112785451 TCCTGTGGCCAGCCTAGTTCAGG + Intergenic
938278206 2:130046405-130046427 TGCTGGGTCAAATGTATTTCTGG + Intergenic
938437172 2:131290982-131291004 TGCTGGGTCAAATGTATTTCTGG - Intronic
943218120 2:185065553-185065575 TGCTTGGTCAAGCTTAGGTCAGG - Intergenic
943724490 2:191238851-191238873 TGCTGTGTCAAGATTATCTCAGG + Intergenic
1168735079 20:127851-127873 TGCTGGGTCAAAGGTATTTCTGG - Intergenic
1173664488 20:44754808-44754830 TGCTGTGTAGGGCGTAGTCCAGG - Intronic
1175750682 20:61495210-61495232 TGATGTGTCAGGCATGGTTCTGG + Intronic
949980107 3:9497200-9497222 TGCTGTCTTAAGCATAATTCTGG - Intergenic
955918187 3:63927190-63927212 TGCTGGGTCAAATGTATTTCTGG + Intronic
964581370 3:158242577-158242599 TGCTGAGTCAAATGTATTTCTGG + Intronic
968273040 3:197419433-197419455 TGCTCTGTCTAGCGCAGATCGGG - Intergenic
971084624 4:23258174-23258196 TGCTGGGTCAAAGGTATTTCTGG - Intergenic
971598341 4:28560623-28560645 TGCTGTGTGAAGTGTAGAACCGG + Intergenic
972013373 4:34212958-34212980 TGCTGGGTCAATGGTATTTCTGG + Intergenic
978168035 4:105632303-105632325 TGCTGTGTCAAGCGTAGTTCTGG + Intronic
986485910 5:8236737-8236759 TGCTGAGTCAATGGTATTTCTGG + Intergenic
989107752 5:37879507-37879529 TGCTCTGTCAAACATAGTTTTGG + Intergenic
994881291 5:105500087-105500109 TGCTGTGTGTAGCTTATTTCTGG + Intergenic
1002952938 6:1833292-1833314 TGATGTGTCCAGTGTTGTTCTGG - Intronic
1005473922 6:26188931-26188953 GGCGGCGTCAAGCGTATTTCTGG - Exonic
1005484324 6:26285354-26285376 GGCGGTGTCAAGCGAATTTCTGG - Exonic
1006358908 6:33576734-33576756 TGCTGTGTGGAGAGTTGTTCCGG + Intronic
1008052143 6:46911146-46911168 TGTTGTGTGAAGAGTACTTCAGG - Intronic
1009881015 6:69566099-69566121 TGCTGGGTCAAATGTACTTCTGG - Intergenic
1011399904 6:86948988-86949010 TTCAGTGTCAAGTGTAGATCAGG - Intronic
1012949785 6:105505534-105505556 TGATGTGTCAAGCTTAGTTTAGG - Intergenic
1016569968 6:145500782-145500804 AGCTGAGTCAAGTGTAGATCTGG + Intergenic
1019256487 7:55755-55777 TGCTTGGTCAAGGGTAGTTATGG + Intergenic
1021051460 7:15990399-15990421 TGCTGGGTCAATGGTATTTCTGG + Intergenic
1029633680 7:101769457-101769479 TGCTATGTCAAGCACTGTTCCGG - Intergenic
1030775573 7:113530344-113530366 TGCTGTGTCAGTTGTGGTTCTGG - Intergenic
1031348628 7:120700853-120700875 CTCTGTGTCAAGCTTAGTTTAGG + Intronic
1033083449 7:138320326-138320348 TGCTGGGTCAAATGTATTTCTGG - Intergenic
1033410943 7:141117042-141117064 TGCTGGGTCAAATGTATTTCTGG + Intronic
1033724579 7:144100854-144100876 TAATGTGTCAGGCATAGTTCAGG - Intergenic
1035097929 7:156371129-156371151 TGCTGTGTGCATCTTAGTTCAGG + Intergenic
1035395312 7:158531176-158531198 TGCTGTGTCAGGCATGGTTTGGG - Intronic
1040754700 8:50758849-50758871 TGCTGGGTCAAATGTATTTCTGG + Intronic
1052378954 9:27749146-27749168 TGCTGTGTCATGCAAAGTTAAGG + Intergenic
1052380666 9:27767475-27767497 TGCTGGGTCAATGGTATTTCTGG - Intergenic
1185669712 X:1797937-1797959 TGCTGGGTCAAATGTATTTCTGG + Intergenic
1186414525 X:9371685-9371707 TGCTGTGCCAAGCTTGGTGCTGG + Intergenic
1186766486 X:12775819-12775841 TGCTCTGTTGAGCCTAGTTCAGG + Intergenic
1187944613 X:24414199-24414221 TTATATGTCAAGCATAGTTCTGG - Intergenic
1199733737 X:150664373-150664395 TGCTGTGGCCAGCCTATTTCTGG - Intronic
1201912596 Y:19147895-19147917 TGCTGTTGCCAGAGTAGTTCAGG - Intergenic