ID: 978171844

View in Genome Browser
Species Human (GRCh38)
Location 4:105681042-105681064
Sequence CTTTGACCCCAAAGGGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978171839_978171844 27 Left 978171839 4:105680992-105681014 CCAAACTGGTTTTGAACTATAAA 0: 1
1: 0
2: 2
3: 20
4: 342
Right 978171844 4:105681042-105681064 CTTTGACCCCAAAGGGAAATTGG 0: 1
1: 0
2: 1
3: 16
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978171844 Original CRISPR CTTTGACCCCAAAGGGAAAT TGG Intronic
900703109 1:4060253-4060275 CTTTGATCTGAAAGGGAAACAGG - Intergenic
901458464 1:9377294-9377316 CTTTGGCCCCAAAGGGAGGCAGG - Intergenic
901905639 1:12407162-12407184 CATTGTCCCAAGAGGGAAATAGG + Intronic
902071814 1:13746145-13746167 GTTTGAACCCAAAGAGAAAGTGG + Intronic
903153931 1:21431227-21431249 CTTGGACCCCAAAGTAAAATGGG - Intergenic
904480408 1:30789697-30789719 GTGGGACCCCAAAGGAAAATTGG + Intergenic
905618718 1:39421433-39421455 CTCTGATTACAAAGGGAAATGGG - Intronic
907063575 1:51456386-51456408 CATTTAACCCAAGGGGAAATGGG + Intronic
910551789 1:88483277-88483299 CTCTTTCCTCAAAGGGAAATGGG - Intergenic
911505170 1:98739853-98739875 CTTTTACCTTTAAGGGAAATGGG + Intronic
915105631 1:153533643-153533665 GTTGGACCCCCAAGGGAAGTGGG + Intergenic
918108049 1:181430002-181430024 CTGTGTCCCAAAAGGGAGATAGG - Intronic
919950853 1:202361952-202361974 CTTTGAGGCCTAAGAGAAATTGG + Intronic
920316475 1:205079050-205079072 CTTTGCCCCCAAAGGGGATGTGG + Intergenic
920438390 1:205962802-205962824 CTTGGATCCCCAAGGGGAATTGG + Intergenic
924058113 1:240143504-240143526 CTTTGACTCCAAAGAGAAGGAGG - Intronic
924499035 1:244619005-244619027 CTTTGACCACAATAGGTAATGGG + Intronic
924654391 1:245960130-245960152 CTCTGAGTCCAAAGGGAAATTGG + Intronic
1064793236 10:18982925-18982947 TTATGTCCCCAAAGGGAACTTGG - Intergenic
1065115946 10:22482440-22482462 CTGTCACCCAAAAGGGAAAAAGG - Intergenic
1069510208 10:69036483-69036505 CTTACACAGCAAAGGGAAATTGG - Intergenic
1071255729 10:83870082-83870104 CTTTGACTCCAAACGGTACTAGG - Intergenic
1073285265 10:102383693-102383715 TTTTGACCCCAAACTGAAAAGGG + Intergenic
1073328989 10:102658724-102658746 CTTGGACCCCATAGGGAGAGGGG + Intergenic
1074145105 10:110710643-110710665 ATTTGCCCCCAAAGGGGAAGGGG - Intronic
1075031252 10:119026126-119026148 ATTTGACCCAGAAGGGAAGTCGG - Intergenic
1075651175 10:124129043-124129065 CCTTGGCCCCCAAGGAAAATGGG + Intergenic
1076340813 10:129743679-129743701 CTATGACCCCACAGGGAAGAAGG - Intronic
1077338342 11:2015303-2015325 CTCAGACCCAAAAGGGAAAAGGG - Intergenic
1082586356 11:54946384-54946406 CATTGACGCCAAAGGCAAAAAGG - Intergenic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1084815240 11:71641921-71641943 CTTGGTCCACAGAGGGAAATGGG + Intergenic
1086643994 11:89196406-89196428 CTGTTACCCAAAAGGGAAAAAGG + Intronic
1088775520 11:113078713-113078735 CTTTGACCCCAAAGGCTATGCGG + Intronic
1089236896 11:117036592-117036614 TTTTCTCCCCAAAGGAAAATAGG + Intronic
1202821326 11_KI270721v1_random:70485-70507 CTCAGACCCAAAAGGGAAAAGGG - Intergenic
1091663312 12:2400410-2400432 CTTTGACCCTAATGAGAACTTGG - Intronic
1093093199 12:14943884-14943906 CTTTATGCCCAAAGGAAAATAGG + Intronic
1095410604 12:41917032-41917054 CTTTGACTTCAAAGGGCAATGGG - Intergenic
1096157382 12:49348042-49348064 CTTTGACCACAGAGTGAAAATGG - Exonic
1097593799 12:61603169-61603191 TTTTGACTCCAGAGGGAAAATGG + Intergenic
1099456740 12:82872194-82872216 CTCTGTCCCAGAAGGGAAATGGG + Intronic
1100211088 12:92399350-92399372 CCTCAACCCCAAAGGGAAAGAGG + Intergenic
1105266583 13:18824002-18824024 CTATGACTCCAAAGGAAAAACGG + Intergenic
1114921011 14:27328722-27328744 ATTTGCCCCCAAAGGACAATTGG - Intergenic
1117031670 14:51678004-51678026 CTTGGAGCCTAAAGTGAAATGGG - Intronic
1119187574 14:72653672-72653694 TTTTGATCCCAAAGTTAAATTGG + Intronic
1119705656 14:76781234-76781256 CATTGACCCCAGGGGGAACTTGG - Exonic
1120255070 14:82107990-82108012 CTTTTACACAAAAGTGAAATTGG - Intergenic
1122399877 14:101460580-101460602 CTTTGAACCGAACAGGAAATGGG + Intergenic
1202831945 14_GL000009v2_random:44079-44101 CTATGACTCCAAAGGAAAAATGG - Intergenic
1123965188 15:25448937-25448959 GTTTGACATAAAAGGGAAATTGG - Intergenic
1125072626 15:35573937-35573959 CTTTGTCTTCAAGGGGAAATGGG + Intergenic
1125360569 15:38860330-38860352 CTATGACCCCTGAAGGAAATGGG - Intergenic
1128557212 15:68639979-68640001 CCCAGACCTCAAAGGGAAATCGG - Intronic
1128943889 15:71808929-71808951 CTTAGACCCCAAGGGGAAGCGGG - Intronic
1130229794 15:82087827-82087849 ATTTGACCCCAAAGGTTAATGGG - Intergenic
1131466919 15:92663187-92663209 CTTTCAACCCTATGGGAAATAGG + Intronic
1131514887 15:93070804-93070826 CCTTGACGCCAAAAAGAAATGGG + Intronic
1131601730 15:93856078-93856100 ATTTGATCTCCAAGGGAAATTGG - Intergenic
1132152746 15:99474252-99474274 CTTTGTATCCACAGGGAAATGGG - Intergenic
1132267398 15:100486386-100486408 CTTTGACCCCCATGGAAAATGGG + Intronic
1132291053 15:100704123-100704145 CTTTGACACCTGGGGGAAATCGG + Intergenic
1134293904 16:12927734-12927756 CTTTGGCCACAAAAGGACATGGG + Intronic
1136587077 16:31193611-31193633 CCTTGACCTTAAAAGGAAATAGG + Exonic
1137877066 16:52006956-52006978 CTTAGAGACCAAAGGGACATGGG + Intronic
1138232799 16:55351739-55351761 ATGTGACCCCTAAGGGCAATTGG + Intergenic
1138989880 16:62378021-62378043 CTTTGTCCCCCAAAGGGAATCGG + Intergenic
1145915651 17:28572554-28572576 CTTCTACCCCAAATGAAAATGGG + Intronic
1147167413 17:38600918-38600940 CTTTCACCCCTCTGGGAAATCGG + Intronic
1147248905 17:39140737-39140759 CCCTGACCCCACTGGGAAATAGG - Intronic
1149078167 17:52621874-52621896 CCTTGACCCCCAAGAGAAATCGG - Intergenic
1150066286 17:62112043-62112065 ATTTTACTCCAAAGGGATATGGG + Intergenic
1154421831 18:14237471-14237493 CTATGACTCCAAAGGAAAAATGG - Intergenic
1157828878 18:50838344-50838366 CATTGAGCCCAAAGGAAAGTAGG - Intergenic
1157928789 18:51796109-51796131 CATAAACCACAAAGGGAAATAGG - Intergenic
1162140726 19:8584261-8584283 TTTTGACCCCCAGGGGACATTGG + Intronic
1165864752 19:38930126-38930148 CTAAGACCACAAAGGAAAATGGG - Intronic
1168036247 19:53721939-53721961 TTTTGTCCCCAAAGAGAAAAAGG - Intergenic
1168318375 19:55494096-55494118 CTTTGCCCCCAAGGGGACATTGG + Intronic
1168321621 19:55513634-55513656 TTTTGCCCCCAAGGGGAATTTGG + Intronic
1202640738 1_KI270706v1_random:83673-83695 CTATGACTCCAAAGGAAAAATGG + Intergenic
931995289 2:67833813-67833835 CTCTGATCACAAAGGGATATTGG - Intergenic
934954694 2:98608119-98608141 ATTTAACCCCACAGGGAACTGGG + Intronic
937091852 2:119211873-119211895 CTGTGACCCCACAGGGGAATGGG + Intergenic
938062890 2:128266448-128266470 CTTGGACCCCAAAGTAAAATGGG + Exonic
941393324 2:164943602-164943624 ATTTGACTACAAAGGGAAATGGG + Intronic
941724970 2:168850853-168850875 TTTTGACCCAAAAGGCATATAGG - Exonic
943374249 2:187055317-187055339 CTTTGTCCCCAGAGGGGATTTGG + Intergenic
944996697 2:205302572-205302594 CTCTGACACCACAGGGAAAGTGG + Intronic
947618234 2:231572164-231572186 CTTTGACCCCTTATGCAAATAGG - Intergenic
1170547737 20:17449351-17449373 CTAAAACCCAAAAGGGAAATGGG - Intronic
1173531035 20:43769715-43769737 CTTTGACCACACTGGTAAATGGG + Intergenic
1174191519 20:48743904-48743926 CTTTGCCCTCAGAGGGCAATGGG - Intronic
1175012942 20:55758134-55758156 CTCTGAACCCAAAAGGAAAAAGG + Intergenic
1176851649 21:13922489-13922511 CCATGACCCCAAAGGAAAAATGG + Intergenic
1177647401 21:23917419-23917441 CTGTGACCCCAAATGGGAACAGG + Intergenic
1179262536 21:39771108-39771130 CTCTGACCCCACAGAGCAATGGG + Exonic
1181966818 22:26662277-26662299 CTTGGACCCCAAAGGGGCAGAGG - Intergenic
1182017960 22:27056534-27056556 TTTAGACCCCAAAGGGTGATGGG - Intergenic
950686366 3:14621398-14621420 CCTGGACCCCACAGGGAAATGGG + Intergenic
954363695 3:50135366-50135388 CTCTGACCCTAAAGGAAAAACGG - Intergenic
956364601 3:68486477-68486499 CTTTGAACACAAACAGAAATGGG + Intronic
957072467 3:75577815-75577837 CTTGGTCCACAGAGGGAAATGGG - Intergenic
958361767 3:92988284-92988306 CTTTGACCCCAATGGTAGAAAGG + Intergenic
959467413 3:106704777-106704799 TATTGACTCCAAAGGGAACTTGG + Intergenic
960926107 3:122795880-122795902 CTTTGACTTCAAAGGGATATGGG + Intronic
964962063 3:162438956-162438978 CTAGGAAGCCAAAGGGAAATAGG - Intergenic
966873287 3:184306402-184306424 CTTTGACTCCAAAGAGAAGGAGG + Exonic
1202737814 3_GL000221v1_random:23714-23736 CTATGACTCCAAAGGAAAAATGG - Intergenic
969737891 4:9003219-9003241 CTTGGTCCACAGAGGGAAATGGG + Intergenic
973384256 4:49494205-49494227 CTATGACTCCAAAGGAAAAATGG + Intergenic
973702821 4:53553603-53553625 CCTAGACCCCAAAGGGAATCTGG - Intronic
975086355 4:70344792-70344814 TTTTTATCCCAAAGGTAAATTGG - Intergenic
978171844 4:105681042-105681064 CTTTGACCCCAAAGGGAAATTGG + Intronic
1202768107 4_GL000008v2_random:169528-169550 CTATGACTCCAAAGGAAAAATGG + Intergenic
985603033 5:844675-844697 CTCTGCACCCAAAGGGAACTCGG + Intronic
986276016 5:6275714-6275736 CCTAGACCCAAAAGGGAAAGGGG + Intergenic
987772590 5:22326003-22326025 ATTTGATCCTAAAAGGAAATGGG + Intronic
988017985 5:25584422-25584444 CTTTTACCACAAAGGGATACTGG + Intergenic
991037509 5:62142874-62142896 ATTTGACACTAAAGGGAGATGGG - Intergenic
991547800 5:67802905-67802927 CTTTGACTTCAAAGGGGTATTGG - Intergenic
992085479 5:73274690-73274712 CTCTGACCCCAAAGAGCCATGGG - Intergenic
994619316 5:102144736-102144758 CTAGGACCCCAAAGGAAAATTGG + Intergenic
994707589 5:103224428-103224450 CTTTGACCCCAAAGGGACTTTGG - Intergenic
996273858 5:121640640-121640662 CTTTGACCCAAAAGGGGCTTTGG - Intergenic
1001461126 5:171915568-171915590 CTTTGAAGCCAAAGAGAAGTTGG + Intronic
1003722133 6:8715703-8715725 CCTTCACCCCAAAGGAAGATGGG - Intergenic
1005152075 6:22763319-22763341 CTTTGATCTTAAAGGGAGATTGG + Intergenic
1005337328 6:24810153-24810175 GTTTGACCCCATAGGTAAAGTGG - Intronic
1006525827 6:34604032-34604054 CTTAGATGCCAAAGAGAAATTGG - Intronic
1006580063 6:35071965-35071987 CTTTTAGCCAAAGGGGAAATAGG - Intronic
1008047720 6:46868417-46868439 CTTTGAAAGCAAAGAGAAATTGG - Intronic
1009543674 6:64999191-64999213 ATTGGATACCAAAGGGAAATCGG + Intronic
1011105788 6:83779284-83779306 TGTTGACATCAAAGGGAAATGGG + Intergenic
1011586935 6:88936189-88936211 CTTTGACCCCAAAGTGCTTTGGG - Intronic
1012180465 6:96146142-96146164 TTTTGACTCCAAAGTGAGATGGG + Intronic
1012465584 6:99513805-99513827 CTTTTGCCTCAAATGGAAATTGG - Intronic
1016538956 6:145141377-145141399 CTTTCTTCCTAAAGGGAAATTGG + Intergenic
1016879007 6:148891793-148891815 CTTTGAACCCAAATGGTAAATGG - Intronic
1020129412 7:5551063-5551085 CTTTGTTCCCTAAGGGCAATGGG + Intronic
1021310658 7:19091914-19091936 CTTTATCCCCAAAGGCAACTTGG - Intronic
1021452303 7:20794690-20794712 CTGTGCCGCCCAAGGGAAATGGG + Intergenic
1021708656 7:23393525-23393547 CCGTGCCCCCAAAGGGAAACAGG + Intronic
1029074729 7:97926768-97926790 TTTGGTCCACAAAGGGAAATGGG - Intergenic
1033564207 7:142562766-142562788 GATAGAGCCCAAAGGGAAATAGG + Intergenic
1033618785 7:143042939-143042961 CTCTGACCACAAAGGTACATAGG + Intergenic
1034377575 7:150659499-150659521 CTTGGTTCCCAAAGGGAAAGGGG - Intergenic
1035892867 8:3364665-3364687 CTTTTACCCCATGGGGATATGGG + Intronic
1038540626 8:28386795-28386817 CATTGAGTCCAAAGGAAAATGGG - Intronic
1040100580 8:43498785-43498807 CTCTGACTCCAAAGGAAAAATGG - Intergenic
1040622696 8:49107362-49107384 CTCTAACCCTAATGGGAAATGGG - Intergenic
1042144799 8:65716535-65716557 CTGTGCACCCAAAGGGACATGGG + Intronic
1043920011 8:85971315-85971337 CTTCGAACCCTAAAGGAAATGGG - Intergenic
1044669230 8:94662084-94662106 CTTTTACCCAAAAGGGCAGTTGG + Intronic
1046096628 8:109570377-109570399 CACTGACCCAAAATGGAAATGGG + Intergenic
1046846762 8:118925369-118925391 CTGTGAGCCCTAAGGCAAATCGG + Intronic
1047843399 8:128778889-128778911 ATTTTACCCCTAAGGGACATTGG - Intergenic
1048549710 8:135422779-135422801 CTATTCCCCTAAAGGGAAATGGG + Intergenic
1051213377 9:14769737-14769759 CATGGACCCCACAGGGAACTCGG - Exonic
1052062094 9:23972994-23973016 TTTTGCCCCCAAATGTAAATGGG + Intergenic
1052254409 9:26437420-26437442 CTTGGAACTCAAAGGGAAGTTGG - Intergenic
1053500225 9:38582790-38582812 CTATGACTCCAAAGGAAAAATGG + Intergenic
1053660843 9:40276802-40276824 CTATGACTCCAAAGGAAAAATGG - Intronic
1053911221 9:42906148-42906170 CTATGACTCCAAAGGAAAAATGG - Intergenic
1054361843 9:64129693-64129715 CTATGACTCCAAAGGAAAAATGG - Intergenic
1054372965 9:64423018-64423040 CTATGACTCCAAAGGAAAAATGG - Intergenic
1054523767 9:66099482-66099504 CTATGACTCCAAAGGAAAAATGG + Intergenic
1054680595 9:67912795-67912817 CTATGACTCCAAAGGAAAAATGG - Intergenic
1057381398 9:94570629-94570651 CTTTGAACATAAAGGGAAATTGG + Intronic
1058287664 9:103200007-103200029 CTGTGACCCTACAAGGAAATGGG - Intergenic
1203692513 Un_GL000214v1:58433-58455 CTATGACTCCAAAGGAAAAATGG + Intergenic
1203706541 Un_KI270742v1:54158-54180 CTATGACTCCAAAGGAAAAATGG - Intergenic
1203556696 Un_KI270744v1:5325-5347 CTATGACTCCAAAGGAAAAATGG + Intergenic
1203643782 Un_KI270751v1:45758-45780 CTATGACTCCAAAGGAAAAATGG - Intergenic
1186128230 X:6438873-6438895 CTTTGTCCCCATAGAGCAATGGG - Intergenic
1187311318 X:18146152-18146174 CTTTGCACCCAAAAGGAAAAGGG - Intergenic
1187648027 X:21370553-21370575 CTTTGGTCCCAAAGGGACAAAGG + Intergenic
1194083927 X:89502633-89502655 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1194603460 X:95952424-95952446 CTTTGACACTAAATGGAAAAAGG + Intergenic
1195265219 X:103173157-103173179 TTTAGACCCCAGTGGGAAATTGG - Intergenic
1195405986 X:104513912-104513934 CAGTGACCCAAAAGGGAAATAGG - Intergenic
1198316798 X:135476123-135476145 CATTGACTCCAAAGATAAATAGG - Intergenic
1198846261 X:140915057-140915079 CTTTGTCCCCAAAGTGTAATTGG - Intergenic
1199496288 X:148456235-148456257 CCATGAGGCCAAAGGGAAATGGG + Intergenic
1199542356 X:148971327-148971349 CTTTATGCCCAAAGGAAAATAGG + Intronic
1200436574 Y:3158513-3158535 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic