ID: 978174913

View in Genome Browser
Species Human (GRCh38)
Location 4:105718240-105718262
Sequence ATGTTGTTGGAGGTGGGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 955
Summary {0: 1, 1: 0, 2: 5, 3: 112, 4: 837}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978174902_978174913 11 Left 978174902 4:105718206-105718228 CCCCTCCAAATTTCATGTTGAAA 0: 66
1: 1111
2: 1969
3: 3026
4: 6172
Right 978174913 4:105718240-105718262 ATGTTGTTGGAGGTGGGACCTGG 0: 1
1: 0
2: 5
3: 112
4: 837
978174903_978174913 10 Left 978174903 4:105718207-105718229 CCCTCCAAATTTCATGTTGAAAT 0: 70
1: 1199
2: 2594
3: 5627
4: 15657
Right 978174913 4:105718240-105718262 ATGTTGTTGGAGGTGGGACCTGG 0: 1
1: 0
2: 5
3: 112
4: 837
978174905_978174913 6 Left 978174905 4:105718211-105718233 CCAAATTTCATGTTGAAATGTGA 0: 46
1: 839
2: 2154
3: 4397
4: 9002
Right 978174913 4:105718240-105718262 ATGTTGTTGGAGGTGGGACCTGG 0: 1
1: 0
2: 5
3: 112
4: 837
978174904_978174913 9 Left 978174904 4:105718208-105718230 CCTCCAAATTTCATGTTGAAATG 0: 52
1: 933
2: 1801
3: 2670
4: 3410
Right 978174913 4:105718240-105718262 ATGTTGTTGGAGGTGGGACCTGG 0: 1
1: 0
2: 5
3: 112
4: 837

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978174913 Original CRISPR ATGTTGTTGGAGGTGGGACC TGG Intronic
900919390 1:5661133-5661155 ATGTTGTTGGAGGCAGGGCTAGG - Intergenic
901671655 1:10859794-10859816 AGGTTGTAGGAGGCAGGACCAGG + Intergenic
902152006 1:14450848-14450870 ACAGTGTTGGAGGTGGGGCCTGG + Intergenic
902378695 1:16042494-16042516 GTGTTGTGGGAGGTGGGATGGGG - Intergenic
903351429 1:22718974-22718996 ATGTTGATGGAGCTGGAAGCTGG - Intronic
903413420 1:23165755-23165777 ATGCTGTTACAGGTAGGACCCGG - Intronic
903896993 1:26613394-26613416 TTGTTGTTGGGGGTGGGGCTGGG - Intergenic
904314740 1:29652932-29652954 CTACTGTTGGAGGTGGGGCCTGG - Intergenic
904817082 1:33211989-33212011 CTGGTGTTGGAGGTGGGATCTGG + Intergenic
904982207 1:34515332-34515354 TTATTGTTGGAGGTGGGGCTTGG - Intergenic
905281417 1:36851819-36851841 AGGATGTTGCAGGTGGGATCAGG + Intronic
905362266 1:37429357-37429379 CCAGTGTTGGAGGTGGGACCTGG + Intergenic
906080084 1:43080554-43080576 TTAGTGTTGGAGGTGGGGCCTGG - Intergenic
906369133 1:45237257-45237279 CCAGTGTTGGAGGTGGGACCCGG + Intronic
906588740 1:47003772-47003794 CTATTGTTGGAGGTGGGTCCTGG - Intergenic
906721857 1:48012174-48012196 CTAATGTTGGAGGTAGGACCTGG + Intergenic
906873657 1:49512416-49512438 CTAATGTTGGAGGTGGGGCCTGG + Intronic
906913888 1:49986255-49986277 ATGTTGTTGGAAGTCAGAACAGG - Intronic
907567960 1:55454824-55454846 ACATTGTTGGAAGTGGGGCCTGG + Intergenic
907578700 1:55552343-55552365 TCATTGTTGGAGGAGGGACCTGG - Intergenic
907804253 1:57802571-57802593 CCATTGTTGGAGGTGGGGCCTGG + Intronic
908263373 1:62355753-62355775 CTGATGTTGGAGGTGGGGCCTGG - Intergenic
908860807 1:68486169-68486191 CCGGTGTTGGAGGTGGGGCCTGG + Intronic
909092861 1:71248155-71248177 CTAATGTTGGAGGAGGGACCTGG + Intergenic
909289306 1:73861882-73861904 TTAATGTTGGAGGAGGGACCTGG - Intergenic
909768470 1:79388367-79388389 TTAATGTTGGAGGTGGGGCCCGG - Intergenic
910278322 1:85471348-85471370 ATGTTTTTAGAGGTGTGAGCAGG - Intronic
910951955 1:92657996-92658018 TCATTGTTGGAGGTGGTACCTGG - Intronic
911922553 1:103784095-103784117 ACAGTGTTGGAGGTGGGGCCTGG - Intergenic
913051345 1:115119467-115119489 ACAGTGTTGGAGGTGGGACCTGG - Intergenic
913057220 1:115173882-115173904 TTCTTGTTGGAGGTGAGAGCAGG + Intergenic
913377347 1:118167783-118167805 CCGGTGTTGGAGGTGGGGCCTGG + Intronic
913396605 1:118378375-118378397 CCATTGTTGGAGGTGGGGCCTGG + Intergenic
914720731 1:150286726-150286748 ATGCTGTAGTAGGTGGGACTGGG - Exonic
914857341 1:151362437-151362459 CTAGTGTTGGAGGTGGGGCCTGG + Intergenic
915311705 1:155008566-155008588 AGGCTACTGGAGGTGGGACCAGG - Intronic
915523656 1:156463406-156463428 ATGGTGTTGGGGGTGGGAGTTGG - Intergenic
915946543 1:160156451-160156473 GTGTTGGTGGGGGTGGGAGCGGG + Intronic
916218268 1:162417542-162417564 CCATTGTTGGAGGTGGGGCCTGG - Intergenic
916339083 1:163708297-163708319 ACAGTGTTGGAGGAGGGACCTGG + Intergenic
917355527 1:174123119-174123141 CCATTGTTGGAGGTGGGGCCTGG - Intergenic
917479223 1:175396603-175396625 CTGATGTTGTAGGTGAGACCTGG + Exonic
917764383 1:178200963-178200985 AGGGTGTTGGAGGTGGGTCCTGG - Intronic
918066232 1:181103896-181103918 AAGCTGTAGGAGGTGGGAACAGG - Intergenic
918430435 1:184454523-184454545 CTGATGTTGGAGGTGGGGCCTGG + Intronic
918485686 1:185026414-185026436 CCAGTGTTGGAGGTGGGACCTGG - Intergenic
918757925 1:188360286-188360308 ATAATGTTGGAGGAGGGGCCTGG + Intergenic
918931262 1:190859370-190859392 CCAGTGTTGGAGGTGGGACCTGG + Intergenic
919055857 1:192569286-192569308 CCAGTGTTGGAGGTGGGACCTGG - Intergenic
919149573 1:193678732-193678754 CCATTGTTGGAGGTGGGGCCTGG + Intergenic
919283075 1:195517640-195517662 CTAGTGTTGGAGGTGGGGCCTGG + Intergenic
919500930 1:198337354-198337376 CCATTGTTGGAGGTGGGGCCTGG + Intergenic
919594103 1:199540053-199540075 ATGTTGTTGTATGTGGTAGCAGG - Intergenic
919951423 1:202367856-202367878 GCAATGTTGGAGGTGGGACCTGG + Intronic
919976675 1:202617266-202617288 CTGATGTTGGAGGTGGGGCCTGG + Intronic
920490681 1:206412379-206412401 AAGTTGTTGGGGGTGGGCACTGG + Intronic
920607550 1:207404139-207404161 CTGATGTTGGAGATGGGACCTGG + Intergenic
920615721 1:207491015-207491037 CAGTTGTTGGAGGTGGGACCTGG - Intergenic
920631462 1:207656817-207656839 ACAATGTTGGAGGTGGGGCCTGG - Intronic
920641947 1:207760942-207760964 ACAATGTTGGAGGTGGGGCCTGG - Intronic
921301391 1:213754429-213754451 TCATTGTTGGAGGTGGGGCCTGG + Intergenic
921933933 1:220778553-220778575 CTACTGTTGGAGGTGGGACCTGG - Intronic
922595679 1:226810947-226810969 CCGATGTTGGAGGTGGGGCCTGG + Intergenic
923325616 1:232877640-232877662 ACCATGTTGGAGGTGGGGCCTGG + Intergenic
923397586 1:233582344-233582366 CCCATGTTGGAGGTGGGACCTGG - Intergenic
923420877 1:233813689-233813711 CTATTGCTGGAGGTGGGGCCTGG - Intergenic
923707647 1:236357770-236357792 CCCATGTTGGAGGTGGGACCTGG - Intronic
923964010 1:239116157-239116179 CTAGTGTTGGAGGTGGGGCCTGG + Intergenic
924312453 1:242758225-242758247 CTGATGTTGGAGGTGGGGCCTGG + Intergenic
924586731 1:245367119-245367141 GTGTAGTTGGAGGTGGCACAGGG - Exonic
1063094637 10:2898830-2898852 CTGTTCTTGGAGGTGGAGCCAGG - Intergenic
1063394491 10:5674283-5674305 ATGTTGGAGGAGGAGGGGCCTGG - Intergenic
1063538533 10:6909328-6909350 CCAATGTTGGAGGTGGGACCTGG - Intergenic
1063718381 10:8553303-8553325 CTAGTGTTGGAGGAGGGACCTGG - Intergenic
1064555968 10:16547466-16547488 CCAGTGTTGGAGGTGGGACCTGG + Intergenic
1065135096 10:22659821-22659843 TTGTTGTTGGGGGTGGGAGGAGG - Intronic
1065147058 10:22780348-22780370 CTGCTGTGGGATGTGGGACCTGG + Intergenic
1065276570 10:24092175-24092197 ATGTGGTTGGAGGTGGCATGAGG - Intronic
1065444130 10:25780196-25780218 CTAATGTTGGAGGTGGGGCCTGG - Intergenic
1065550305 10:26862981-26863003 CTAATGTTGGAGTTGGGACCTGG + Intergenic
1065570584 10:27067748-27067770 CCAGTGTTGGAGGTGGGACCTGG - Intronic
1065871353 10:29959032-29959054 TGGTATTTGGAGGTGGGACCTGG + Intergenic
1066107998 10:32172329-32172351 ATGTTGTGGGGGGTGGGACGCGG - Intergenic
1066131915 10:32402865-32402887 AAGTTGTTGGAGTTTGGGCCTGG + Intergenic
1066673443 10:37863366-37863388 CCATTGTTGGAGGTGGGTCCTGG + Intergenic
1067311191 10:45115094-45115116 CCATTGTTGGAGGTGGGGCCTGG - Intergenic
1067827627 10:49589804-49589826 TGATTGTTGGAGGTGGGGCCTGG - Intergenic
1068523744 10:58105399-58105421 CTGGTGTTGGAGGTGGAGCCTGG + Intergenic
1068542363 10:58309518-58309540 CCAGTGTTGGAGGTGGGACCTGG + Intergenic
1068960856 10:62864996-62865018 GTGTTGATGTAGGTGGTACCTGG - Intronic
1069170961 10:65228385-65228407 CCAGTGTTGGAGGTGGGACCTGG + Intergenic
1069202408 10:65637276-65637298 CTAATGTTGGAGGTGGGGCCTGG - Intergenic
1069217704 10:65842656-65842678 CCAGTGTTGGAGGTGGGACCTGG - Intergenic
1069550575 10:69361062-69361084 AAGTTCTTGTGGGTGGGACCTGG + Intronic
1069598945 10:69690859-69690881 GCAGTGTTGGAGGTGGGACCTGG + Intronic
1069638659 10:69941128-69941150 CTGGTGTCGGAGGTGGGACCAGG - Intronic
1070030086 10:72668521-72668543 TTGTTGTTAGAGATGGGATCTGG + Intergenic
1070384008 10:75907730-75907752 ATGGTGTTGGAAATGGCACCAGG - Intronic
1071076076 10:81754542-81754564 ATGTTTTTGGTGGTGGGAGAGGG - Intergenic
1071227910 10:83553030-83553052 CTGATGTTGGAGCTGGGGCCAGG - Intergenic
1071257395 10:83883824-83883846 CTGCTGTTGGAGGTGGGGCCTGG + Intergenic
1072301593 10:94067298-94067320 GAGTTTTTGGAGGTGGGCCCTGG + Intronic
1072474836 10:95750307-95750329 CCAATGTTGGAGGTGGGACCTGG + Intronic
1072571464 10:96661509-96661531 ATGTTGATGGGGGTGGGAGGAGG + Intronic
1074497332 10:113991547-113991569 ATGTTGTTGGAGTGGGGCCTAGG + Intergenic
1074581884 10:114726869-114726891 CCATTGTTGGAGGTGGGGCCTGG - Intergenic
1074773826 10:116751721-116751743 CCAATGTTGGAGGTGGGACCTGG + Intergenic
1074881917 10:117666280-117666302 CCGATGTTGGAGGTGGGGCCTGG - Intergenic
1075016665 10:118914667-118914689 CTGATGCTGGAGGTGGGGCCTGG - Intergenic
1075851002 10:125586877-125586899 CCGGTGTTGGAGGTGGGGCCTGG + Intronic
1075959535 10:126556615-126556637 GTATTGTTGGCTGTGGGACCAGG + Intronic
1076179051 10:128391782-128391804 CTGGTGTTGCAGGTGGGGCCGGG - Intergenic
1076240178 10:128899153-128899175 CTGGTGTTAGAGGAGGGACCTGG + Intergenic
1076312213 10:129516701-129516723 ATGTTATTGGTGGTGGGGGCTGG - Intronic
1076378623 10:130009935-130009957 CCAGTGTTGGAGGTGGGACCTGG + Intergenic
1076745570 10:132511396-132511418 CCAGTGTTGGAGGTGGGACCTGG - Intergenic
1076838466 10:133032926-133032948 CCCGTGTTGGAGGTGGGACCTGG + Intergenic
1077695434 11:4388900-4388922 AGGTTGTTGGAGGTGGGAACAGG - Intronic
1077730573 11:4724944-4724966 CTATTGTTGGAGGTGGGGCCTGG + Intronic
1078576146 11:12504149-12504171 CCGGTGTTGGAGGTGGGGCCTGG - Intronic
1078806581 11:14711692-14711714 CCAATGTTGGAGGTGGGACCTGG - Intronic
1079274944 11:19026634-19026656 CCAGTGTTGGAGGTGGGACCTGG - Intergenic
1079568191 11:21909150-21909172 AACTGATTGGAGGTGGGACCAGG + Intergenic
1079650703 11:22925309-22925331 ATCTAGTTGGAGGTGGGAGATGG - Intergenic
1079861247 11:25674393-25674415 CCAATGTTGGAGGTGGGACCTGG + Intergenic
1079915054 11:26359253-26359275 AAGTTCTGTGAGGTGGGACCAGG + Intronic
1080256001 11:30291152-30291174 TTATTGTTGGAGGTAGGGCCTGG - Intergenic
1080354943 11:31432252-31432274 ATATTGTGGGAGGGGGAACCTGG - Intronic
1080367331 11:31590883-31590905 CCATTGTTGGAGGTGGGACCTGG - Intronic
1080480754 11:32647415-32647437 CCAATGTTGGAGGTGGGACCTGG - Intronic
1080484413 11:32690490-32690512 ACGTTGTTGGAGGAGGGGCCTGG + Intronic
1080562198 11:33474182-33474204 TCGATGTTGGAGGTGGGGCCTGG - Intergenic
1080653889 11:34243485-34243507 CTGTTGTTGGAGGAGGGGCAGGG - Intronic
1080929067 11:36788393-36788415 CTGATATTGGAGGTGGGGCCTGG + Intergenic
1081093144 11:38897999-38898021 CCAGTGTTGGAGGTGGGACCTGG + Intergenic
1081208270 11:40300241-40300263 CTAATGTTGGAGGTGGGGCCAGG - Intronic
1081395933 11:42586230-42586252 AAATTGTTGGAGGAGGGGCCTGG - Intergenic
1081783824 11:45732561-45732583 CCATTGTTGGAGGTGGGGCCTGG - Intergenic
1082644777 11:55709258-55709280 CCAGTGTTGGAGGTGGGACCTGG + Intergenic
1082711616 11:56559992-56560014 CTACTGCTGGAGGTGGGACCTGG + Intergenic
1083573194 11:63770774-63770796 AGGTTGTTGAAGGTGGCTCCAGG - Intergenic
1083775011 11:64890364-64890386 CTGTTGTGGGAGGCGGGACAGGG + Intergenic
1084577546 11:69999390-69999412 CCACTGTTGGAGGTGGGACCTGG - Intergenic
1085383909 11:76145077-76145099 CCCATGTTGGAGGTGGGACCTGG + Intergenic
1085986904 11:81798951-81798973 CCATTGTTGAAGGTGGGACCTGG + Intergenic
1086239568 11:84673092-84673114 CTAATGTTGGAGGTGGGGCCTGG - Intronic
1087165737 11:95000371-95000393 TTTGTGTTGGAGGTGGGGCCTGG - Intergenic
1087168685 11:95028504-95028526 CTAATGTTGGAGGTGGGGCCTGG + Intergenic
1088114877 11:106302653-106302675 ATGATGATGGAGGTGGGAGCTGG + Intergenic
1088460254 11:110075228-110075250 TCGCTGTTGGAGGTGGGGCCTGG - Intergenic
1088488937 11:110368394-110368416 CCACTGTTGGAGGTGGGACCTGG - Intergenic
1088545530 11:110955126-110955148 CCAATGTTGGAGGTGGGACCTGG - Intergenic
1088566520 11:111178406-111178428 CCAGTGTTGGAGGTGGGACCTGG + Intergenic
1088923399 11:114278366-114278388 TTAATGTGGGAGGTGGGACCTGG - Intronic
1089074208 11:115725106-115725128 CCATTGTTGGAGGTGGGAACTGG + Intergenic
1089379828 11:118020631-118020653 ATGTTGTTGTAAGTGTGAACAGG + Intergenic
1089590930 11:119540366-119540388 AGGTTGTTGGAGGAGGCACAGGG - Intergenic
1090517836 11:127447753-127447775 CTATTTTTGGAGGTGGGAGCTGG - Intergenic
1090660207 11:128876732-128876754 GTGTTGTCGGTGGTGAGACCAGG + Intergenic
1090749842 11:129736086-129736108 ATCTTGCTGGAGGTGGGGACTGG + Intergenic
1091371501 11:135063863-135063885 ACAATGTTGGAAGTGGGACCTGG - Intergenic
1091431989 12:443990-444012 ATGTTATTGGAATTGAGACCAGG - Intergenic
1091445516 12:542514-542536 AGGTTGTGGGAGGTGGGGCCTGG - Intronic
1091552641 12:1548446-1548468 CCAATGTTGGAGGTGGGACCTGG + Intronic
1091713833 12:2762157-2762179 AGGTGGTGGGAGGGGGGACCAGG + Intergenic
1092573504 12:9752047-9752069 CCTTTGTTGGAGGTGGGGCCTGG - Intergenic
1092674173 12:10897826-10897848 CTAATGTTGGAGGTGGGGCCTGG - Intronic
1092779080 12:11968703-11968725 ATGGTGGTGGAGGTGGGGCCCGG + Intergenic
1093207612 12:16269246-16269268 AGGAGGTTCGAGGTGGGACCTGG + Intronic
1093371751 12:18374710-18374732 TCAGTGTTGGAGGTGGGACCTGG + Intronic
1094322914 12:29204918-29204940 CCATTGTTGGAGGTGGGGCCTGG - Intronic
1096015078 12:48263917-48263939 CTGGTGTTGGAGGGGGGCCCTGG - Intergenic
1096599837 12:52721543-52721565 GTGTGGCTGGAGGTGGCACCTGG - Intergenic
1096907503 12:54948413-54948435 CCATTGTTGGAGGTGGGGCCTGG + Intronic
1097270596 12:57771831-57771853 CAGTTTTTGGGGGTGGGACCGGG - Intronic
1097597757 12:61654994-61655016 CTAATGTTGGAGGTGGGGCCTGG - Intergenic
1097812521 12:64034129-64034151 CCAGTGTTGGAGGTGGGACCTGG + Intronic
1098356916 12:69620733-69620755 ATGGAGTTGGAGGTGGGGGCTGG + Intergenic
1098408153 12:70149391-70149413 ATTTAGTTGGAGGTGGAGCCTGG - Intergenic
1098694012 12:73528748-73528770 CTAATGTTGGAGGTGGGGCCTGG + Intergenic
1099796884 12:87410746-87410768 CTGGTGTTGGAGATGGGGCCTGG + Intergenic
1099893015 12:88612238-88612260 CTAGTGTTGGAGGTGGGGCCTGG + Intergenic
1100142619 12:91636786-91636808 CTGATGTTGGAGGTGTGGCCTGG + Intergenic
1100216840 12:92459175-92459197 GCGGTGTTGGAGGTGGGACCTGG - Intergenic
1101221773 12:102648907-102648929 CTAGTGTTGGAGGTGGGGCCTGG - Intergenic
1101577509 12:106011572-106011594 CTAGTGTTGGAGGTGGGGCCTGG + Intergenic
1101621747 12:106395542-106395564 CCATTGTTGGAGGTGGGGCCTGG - Intronic
1103076649 12:117988561-117988583 CTAATGTTGGAGGTGGGGCCTGG + Intergenic
1103446870 12:121000436-121000458 ATGGGCTTTGAGGTGGGACCTGG - Intronic
1103731559 12:123031334-123031356 ATTTTGTTGGAGCTCGGACTGGG + Intronic
1104099142 12:125589831-125589853 CTAATGTTGGAGGTGGGGCCTGG - Intronic
1104459103 12:128939870-128939892 CCATTGTTGGAGGTGGGGCCTGG - Intronic
1104468313 12:129007880-129007902 CCGATGTTGGAGGTGGGGCCTGG + Intergenic
1105259664 13:18769568-18769590 TTAATGTTGGAGGTGGGGCCTGG - Intergenic
1105262340 13:18788885-18788907 TTAATGTTGGAGGTGGGGCCTGG - Intergenic
1105557611 13:21461111-21461133 CCAGTGTTGGAGGTGGGACCTGG + Intergenic
1105589815 13:21781727-21781749 GTGTTGATGGAGGTGGGGTCAGG + Intergenic
1105713665 13:23038914-23038936 TTGTTGTCTGAGGTGGTACCTGG + Intergenic
1107114636 13:36733749-36733771 CTCATGTTGGAGGTGGGGCCTGG + Intergenic
1107135857 13:36943332-36943354 CTAGTGTTGGAGGAGGGACCTGG + Intergenic
1107870268 13:44739854-44739876 CTAATGTTGGAGGTGGGGCCTGG - Intergenic
1108005112 13:45938479-45938501 CTGATGTTGGAGGTGGGGCCTGG + Intergenic
1108158347 13:47611566-47611588 TTAGTGTTGGAGGTGGGGCCTGG - Intergenic
1108368946 13:49747807-49747829 ATTTTGTGGAAGGTGGGACTTGG + Intronic
1108392826 13:49964508-49964530 CCAATGTTGGAGGTGGGACCTGG + Intergenic
1108445201 13:50501642-50501664 CCATTGTTGGAGGTGGGGCCTGG - Intronic
1108511818 13:51163189-51163211 ATGTTCTTTGAGGTTAGACCAGG - Intergenic
1108612541 13:52097873-52097895 CTGATGTTGGAGGAGGGGCCTGG + Intronic
1108680274 13:52774101-52774123 CTGGTGTTGAAGGTGGGACCTGG - Intergenic
1108843807 13:54653538-54653560 CTAATGTTGGAGGTGGGGCCTGG + Intergenic
1109166521 13:59041605-59041627 TCATTGTTGGAGGTGGGGCCTGG - Intergenic
1109532265 13:63665124-63665146 TGAATGTTGGAGGTGGGACCTGG - Intergenic
1109634229 13:65092512-65092534 TTAATGTTGGAGGTGGGGCCAGG - Intergenic
1109729127 13:66387416-66387438 CCATTGTTGGAGGTGGGGCCTGG + Intronic
1109887812 13:68565077-68565099 CTAATGTTGGAGGTGGGGCCTGG - Intergenic
1110495411 13:76162185-76162207 CCAGTGTTGGAGGTGGGACCTGG - Intergenic
1110551934 13:76820404-76820426 GTGCTGTTGGAGGTGGGCCTAGG - Intergenic
1110772673 13:79367467-79367489 ACGATGTTGGAGGTGGGGCCTGG + Intronic
1110872977 13:80474336-80474358 ATGTTGTTGCTGGTGGTACATGG - Intergenic
1110901982 13:80835496-80835518 CCAGTGTTGGAGGTGGGACCTGG - Intergenic
1110917941 13:81046793-81046815 CTAGTGTTGGAGGTGGGGCCTGG - Intergenic
1111443052 13:88305269-88305291 CTGGTGTTGGATGTGGGGCCTGG + Intergenic
1111659762 13:91194283-91194305 ACGGTGTTGGAGGTGAGGCCTGG + Intergenic
1112176459 13:97030192-97030214 CCAGTGTTGGAGGTGGGACCTGG - Intergenic
1112192764 13:97193871-97193893 ATGATGTGGGAGGTGTGATCAGG - Intergenic
1112229660 13:97575800-97575822 CCAATGTTGGAGGTGGGACCTGG - Intergenic
1112363667 13:98739420-98739442 CAATTGTTGGAGGTGGGACCTGG + Intronic
1112912047 13:104498276-104498298 ATGTTGTTAGTGGTGGGGCTTGG - Intergenic
1113356087 13:109581614-109581636 CCAGTGTTGGAGGTGGGACCTGG - Intergenic
1115095901 14:29635323-29635345 ATGTTGTGGGAAGGGGGACAAGG - Intronic
1115552711 14:34519049-34519071 CCAATGTTGGAGGTGGGACCTGG + Intronic
1115874622 14:37846478-37846500 CCAATGTTGGAGGTGGGACCTGG + Intronic
1116211721 14:41954751-41954773 ACATTGTTGGAGGTGGGGCCTGG - Intergenic
1116216604 14:42024907-42024929 CCATTGTTGGAGGTGGGGCCAGG + Intergenic
1116333245 14:43622213-43622235 CCGATGCTGGAGGTGGGACCTGG - Intergenic
1116475650 14:45335651-45335673 ACAATGTTGGAGGTGGGGCCTGG - Intergenic
1116507173 14:45698453-45698475 TCATTTTTGGAGGTGGGACCTGG + Intergenic
1116713892 14:48404225-48404247 CAGTTGTTGGAGGTGGGACCTGG - Intergenic
1116715441 14:48419993-48420015 CCAGTGTTGGAGGTGGGACCTGG + Intergenic
1117281257 14:54243254-54243276 CTAGTGTTGGAGGTGGGGCCTGG - Intergenic
1117496689 14:56312630-56312652 CTGATGTTGGAGGTGGGGCCTGG - Intergenic
1117881685 14:60318917-60318939 CCAGTGTTGGAGGTGGGACCTGG + Intergenic
1117886549 14:60370332-60370354 TTAGTGTTGGAGGTGGGGCCTGG + Intergenic
1118101721 14:62613223-62613245 CTAGTGTTGGAGGTGGGGCCTGG - Intergenic
1118603694 14:67488128-67488150 ATGTGGCTGGGGGTGGGAGCTGG + Intronic
1118935629 14:70285217-70285239 ATAATATTGGAGGTGGGACCGGG - Intergenic
1119992734 14:79217445-79217467 ATTATGTTGGAGATGGGGCCTGG - Intronic
1120326611 14:83037557-83037579 ATGTTGTGGGAGGAGGAACCTGG - Intergenic
1121162689 14:91759740-91759762 CTAATGTTGGAGGTGGGGCCTGG + Intronic
1121463908 14:94102112-94102134 TTCTGGTTGGAGGTGGGACCAGG + Intronic
1121500394 14:94431295-94431317 CCGGTGTTGGAGGTGGGGCCTGG + Intergenic
1121606444 14:95243880-95243902 CTAATGTTGGAGGTGGGGCCTGG + Intronic
1121707824 14:96012397-96012419 TTAATGTTGGAGGTGGGGCCTGG - Intergenic
1122039474 14:98973597-98973619 CCGATGTTGGAGGTGGGGCCTGG - Intergenic
1122159105 14:99769905-99769927 ATGTGGTTGGAGGGGTGAACTGG - Intronic
1122777432 14:104127259-104127281 ATGTTGTTGCAGGTACGCCCTGG + Intergenic
1122850192 14:104523853-104523875 CTAGTGCTGGAGGTGGGACCCGG - Intronic
1123102093 14:105811208-105811230 CCGGTGTTGGAGGTGGGGCCTGG - Intergenic
1123967243 15:25471458-25471480 TGGTTGTTGGGGGTGGGATCGGG + Intergenic
1124416713 15:29478503-29478525 CTGATGCTGGAGGTGGGGCCTGG + Intronic
1124463158 15:29911686-29911708 ACAGTGTTGGAGGAGGGACCTGG - Intronic
1125170368 15:36759939-36759961 CAATTGTTGGAGGTGGGGCCTGG - Intronic
1125606102 15:40940878-40940900 ATGTTGTTAAAGGTGGAGCCTGG - Intergenic
1125713306 15:41804479-41804501 CTCTTGTTGGAGGTGGGGCTGGG + Intronic
1126490794 15:49233367-49233389 CCAGTGTTGGAGGTGGGACCTGG - Intronic
1126663266 15:51052706-51052728 CTGGTGTTGGAGGCGGGGCCTGG + Intergenic
1126900514 15:53309715-53309737 CTGATGTTGGAGGTGGGGCCTGG - Intergenic
1127124212 15:55796483-55796505 ATGTCTTTGGCAGTGGGACCTGG - Intergenic
1128680017 15:69643671-69643693 CCGTTATTGGAGGTGGGGCCTGG - Intergenic
1128690654 15:69722205-69722227 ATGTTGTCGGAGGTGGGAGGAGG - Intergenic
1129480994 15:75826139-75826161 TTGTTATGGGAGGTGGGACAGGG + Intergenic
1131439761 15:92450723-92450745 CTAATGTTGGAGGTGGGACCTGG - Intronic
1131453463 15:92565080-92565102 CTCATGTTGGAGGTGGGGCCTGG - Intergenic
1131593557 15:93773940-93773962 ATGTGGTGGGAGGTGGGAGAGGG - Intergenic
1131644744 15:94329666-94329688 CTAATGTTGGAGGTGGGGCCCGG - Intronic
1131733837 15:95311376-95311398 CTCATGTTGGAGGTGGGGCCTGG + Intergenic
1132077121 15:98831109-98831131 CCATTGTTGGAGGTGGGGCCTGG - Intronic
1132166126 15:99592825-99592847 CTAATGTTGGAGGTGGGACTTGG - Intronic
1132896195 16:2230473-2230495 ATGCTGTGGGAGGTGGGGCGGGG + Intronic
1133386347 16:5373328-5373350 CTGATGTTGGAGGAGGGACCCGG + Intergenic
1133644947 16:7755172-7755194 GTGGGGTTGGGGGTGGGACCAGG + Intergenic
1133970522 16:10564572-10564594 ATGAGGTAGGAGGTGGGACTGGG - Intronic
1134064078 16:11215756-11215778 CCGATGTTGGAGGTGGGGCCTGG + Intergenic
1134126562 16:11620215-11620237 ACAATGTTGGAGGTGGGGCCTGG + Intronic
1134768253 16:16781359-16781381 CCGATGTTGGAGGTGGGACCTGG + Intergenic
1134816868 16:17213068-17213090 ACAGTGTTGGAGGTGGGACCTGG + Intronic
1134863749 16:17585763-17585785 ACAGTGTTGGAGGTGGGGCCTGG - Intergenic
1135021929 16:18970105-18970127 CCACTGTTGGAGGTGGGACCTGG - Intergenic
1135022818 16:18977065-18977087 CCGGTGTTGGAGGTGGGGCCTGG + Intergenic
1135055608 16:19229542-19229564 CTAATGTTGGAGGTGGGGCCTGG - Intronic
1137333700 16:47527132-47527154 CCAGTGTTGGAGGTGGGACCTGG - Intronic
1137746955 16:50829291-50829313 CTAATGTTGGAGGTGGGGCCTGG + Intergenic
1137836448 16:51597034-51597056 ACAATGTTGGAGGTGGGGCCTGG + Intergenic
1137982452 16:53081356-53081378 ATGTTTTGGGAGGTGGTAGCTGG + Intronic
1138038683 16:53636446-53636468 ATATTCTTGGAGATAGGACCTGG + Exonic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1138525847 16:57606892-57606914 TTGGTGTTGGAGGTGGCACCCGG + Intergenic
1138723080 16:59104796-59104818 CTGATGTTGGAGGTGGGGTCTGG + Intergenic
1138999648 16:62494203-62494225 GTGATCTTGGAGGTGGGACCTGG + Intergenic
1139151409 16:64386458-64386480 TTGTGTTTGGAGGTGAGACCTGG + Intergenic
1140884229 16:79228893-79228915 ATGTTGCTGGAGGGAGGAACTGG - Intergenic
1142433595 16:90043591-90043613 CTGTGGTCGGAGGTGAGACCAGG - Exonic
1142969430 17:3601266-3601288 GGGTTGTGGGAGGTTGGACCAGG - Intergenic
1143352661 17:6299934-6299956 CCATTGTTGGAGGTGGGGCCTGG + Intergenic
1143427310 17:6850214-6850236 CTATTGTTGGAGGTAGGGCCTGG + Intergenic
1143458461 17:7083495-7083517 CCGATGTTGGAGGTGGGGCCTGG - Intergenic
1144135340 17:12289807-12289829 ATGCTCTTGGAGGTGTGGCCTGG - Intergenic
1144682911 17:17206822-17206844 ACGTGGTGGGAGGTGGAACCTGG - Intronic
1146552491 17:33793623-33793645 ATCTTGTAGGAGGTAGGATCTGG + Intronic
1147476143 17:40713321-40713343 CTGATGCTGGAGGTGGGGCCTGG + Intergenic
1148052965 17:44778148-44778170 ATGTTGGTGCCGCTGGGACCTGG - Exonic
1148144618 17:45355195-45355217 AGGATGTTGGAGGTGGGACAAGG + Intergenic
1148828783 17:50415393-50415415 ATGGTTTTGGAGGTTGGGCCTGG + Intergenic
1149425683 17:56552089-56552111 CTGGTGTTGGAGGAGGGACCTGG - Intergenic
1149451313 17:56752054-56752076 CTGTTTATGGAGGTGGGAGCAGG + Intergenic
1151122333 17:71807270-71807292 CTCATGTTGGAGGTGGGGCCTGG - Intergenic
1151180130 17:72321288-72321310 CTGTTGTTGGAGGTGGGGCCTGG - Intergenic
1151389416 17:73775795-73775817 AAGTTTTTGGAGAAGGGACCTGG + Intergenic
1151427507 17:74040618-74040640 ATGTTGCTGGAGTTGGTGCCGGG - Intergenic
1151989694 17:77566427-77566449 CCAGTGTTGGAGGTGGGACCTGG - Intergenic
1153070136 18:1095964-1095986 ATGTAGGTGGAGGTGGGTGCTGG + Intergenic
1153778385 18:8473631-8473653 CCGGTGTTGGAGGTGGGGCCTGG - Intergenic
1153922824 18:9806435-9806457 ATGCTGGTGGAGGAGGGTCCAGG + Intronic
1154408309 18:14117902-14117924 CTAATGTTGGAGGTGGGGCCTGG - Intronic
1154426364 18:14275244-14275266 TTAATGTTGGAGGTGGGGCCTGG + Intergenic
1154429105 18:14294829-14294851 TTAATGTTGGAGGTGGGGCCTGG + Intergenic
1154431377 18:14311173-14311195 TTAGTGTTGGAGGTGGGGCCTGG + Intergenic
1154434054 18:14330479-14330501 TTAGTGTTGGAGGTGGGGCCTGG + Intergenic
1155683157 18:28514766-28514788 CCATTGTTGGAGGTGGGGCCTGG + Intergenic
1156909954 18:42400078-42400100 CTGGTGTTGGAGGTGGGGCCTGG + Intergenic
1157715906 18:49886993-49887015 CTAATGTTGGAGGTGGGGCCTGG + Intronic
1157807757 18:50670859-50670881 CTGTTGTTTGAGATGGAACCTGG - Intronic
1157957287 18:52112451-52112473 CTAGTGTTGGAGGTGGGGCCTGG - Intergenic
1158608930 18:58920892-58920914 GTGGTGTTGGAGGTGGTAGCAGG + Intronic
1158855873 18:61542967-61542989 CCATTGTTGGAGGTGGGGCCTGG - Intronic
1159597328 18:70394982-70395004 CCATTGTTGGAGGTGGGGCCTGG - Intergenic
1159714254 18:71801799-71801821 CTGATGTTGGAGGAGGGACCTGG - Intergenic
1163007540 19:14406164-14406186 GCGTTGTTGGGGGTGGGCCCTGG + Intronic
1163668524 19:18614084-18614106 AGGCTGTGGGAGGTGGGAGCGGG - Exonic
1164749159 19:30638624-30638646 AAAATGTTGGAGGTGGGGCCTGG - Intronic
1165354532 19:35295534-35295556 ATGTGGTTGGGGATGGGAGCCGG + Intronic
1166895222 19:46018435-46018457 ATGGTGTGGGGGGTGGGGCCAGG + Exonic
1167390437 19:49191165-49191187 CTAATGTTGGAGGTGGGGCCTGG - Intronic
1167400022 19:49259426-49259448 CTACTGTTGGAGGTGGGGCCTGG + Intergenic
1167675127 19:50879095-50879117 ATGTTGTTGAAGGAGGGACTAGG + Exonic
1167703757 19:51066142-51066164 ATGAGGTTGGAGATGGGACTGGG - Intergenic
1167998200 19:53423852-53423874 GTGTGGTTGGAGGGGGGATCAGG - Intronic
1168576473 19:57515833-57515855 ATTTTGTTTGAGGTGGTAGCTGG - Intronic
925264006 2:2551934-2551956 CCATTGTTGGAGGTGGGGCCTGG - Intergenic
925562149 2:5208492-5208514 CCGGTGTTCGAGGTGGGACCTGG + Intergenic
925758302 2:7156615-7156637 CTATTGTTGGAGCTGGGTCCTGG + Intergenic
925868616 2:8250361-8250383 CCGTTGTTGTAGGAGGGACCTGG + Intergenic
925900535 2:8506131-8506153 CCATTGTTGGAGGTGGGGCCTGG + Intergenic
926226028 2:10967482-10967504 AGGTTTTTGGAGGTGGGGGCAGG + Intergenic
926378954 2:12264871-12264893 TTAATGTTGGAGGTGGGATCAGG - Intergenic
927033923 2:19151974-19151996 ACAATGTTGGAGGTGGGGCCTGG - Intergenic
927091039 2:19712877-19712899 CTGATGTTGGAGATGGGGCCTGG - Intergenic
927222933 2:20731201-20731223 CCAATGTTGGAGGTGGGACCTGG + Intronic
927311769 2:21639589-21639611 ACAATGTTGGAGGTGGGGCCTGG - Intergenic
927863330 2:26573886-26573908 CTGTTGAGGGTGGTGGGACCAGG + Intronic
928231195 2:29500176-29500198 CCAGTGTTGGAGGTGGGACCTGG + Intronic
928446978 2:31341246-31341268 ATGTTGTGGCAGGTGGCCCCAGG + Intronic
929368899 2:41196871-41196893 CCATTGTTGGAGGTGGGTCCTGG - Intergenic
929894343 2:45945492-45945514 CCAATGTTGGAGGTGGGACCTGG - Intronic
930260597 2:49141568-49141590 CCATTGTTGGAGGTGGGGCCTGG - Intronic
930586910 2:53277920-53277942 CTGATGTTAGAGGTGGGGCCTGG - Intergenic
930612493 2:53558513-53558535 CCAATGTTGGAGGTGGGACCTGG - Intronic
930687659 2:54326323-54326345 ATGTTGTCAGAGAAGGGACCTGG + Intergenic
930832254 2:55757543-55757565 CTAGTGTTGGAGGTGGGGCCTGG - Intergenic
930867201 2:56133609-56133631 CCAGTGTTGGAGGTGGGACCTGG + Intergenic
931704448 2:64935799-64935821 CTGGTGTTGGAGGTGGGGCCTGG + Intergenic
931943452 2:67278715-67278737 ATTTTGAAGGAGGTGGGACTTGG - Intergenic
932313039 2:70759482-70759504 ATGTTGAAGGAGGGGGTACCTGG + Intronic
932361022 2:71105812-71105834 CCATTGTTGGAGGTGGGACCTGG - Intergenic
933476583 2:82799243-82799265 CTAGTGTTGGAGGTGGGACCTGG - Intergenic
933518062 2:83331351-83331373 CTAGTGTTGGAGGAGGGACCTGG - Intergenic
933596069 2:84284565-84284587 CCAATGTTGGAGGTGGGACCTGG + Intergenic
933985939 2:87592224-87592246 CTAGTGTTGGAGGTGGGACCTGG + Intergenic
933989558 2:87624542-87624564 CTAGTGTTGGAGGTGGGGCCTGG - Intergenic
934491613 2:94764937-94764959 TTAATGTTGGAGGTGGGGCCAGG - Intergenic
934611385 2:95739526-95739548 CTGGTGTTGGAGGTGGGGCCTGG + Intergenic
934694150 2:96386584-96386606 CTGGTGTTGGAGGTGGGGCCTGG + Intergenic
935160907 2:100528636-100528658 CCAGTGTTGGAGGTGGGACCTGG - Intergenic
935172653 2:100622533-100622555 ACAGTGTTGGAAGTGGGACCTGG + Intergenic
935931557 2:108132573-108132595 CTAGTGTTGGAGGTGGGGCCTGG - Intergenic
936229252 2:110685524-110685546 CCAGTGTTGGAGGTGGGACCTGG - Intergenic
936304285 2:111326284-111326306 CTAGTGTTGGAGGTGGGGCCTGG + Intergenic
936307898 2:111358580-111358602 CTAGTGTTGGAGGTGGGACCTGG - Intergenic
936474510 2:112828115-112828137 CCGATGTTGGAGGTGGGGCCTGG - Intergenic
936611151 2:114003257-114003279 CCAGTGTTGGAGGTGGGACCTGG - Intergenic
936907075 2:117549251-117549273 CCCATGTTGGAGGTGGGACCTGG + Intergenic
937252776 2:120534799-120534821 ATGTTTTTTGAGGGGTGACCAGG - Intergenic
937447048 2:121967270-121967292 CCAGTGTTGGAGGTGGGACCTGG - Intergenic
937570394 2:123351159-123351181 TTGATGTTGGAGGTGGAGCCTGG + Intergenic
937701997 2:124873337-124873359 CTAATGTTGGAGGTAGGACCTGG - Intronic
937995604 2:127691936-127691958 ACGATGTTGGAAGTGGGGCCTGG - Intergenic
938142946 2:128811647-128811669 ATGTTGTTGGGGTTGGCCCCAGG + Intergenic
938218745 2:129546806-129546828 CTAGTGTTGGAGATGGGACCTGG - Intergenic
938410768 2:131062070-131062092 ATGTTGATGGATGTGGGTCGTGG - Intronic
938591320 2:132738935-132738957 CCATTGTTGGAAGTGGGACCTGG - Intronic
939176222 2:138750857-138750879 TCAGTGTTGGAGGTGGGACCTGG + Intronic
939242036 2:139573429-139573451 CTGATGTTGGAGGTGGAGCCTGG + Intergenic
939463360 2:142526518-142526540 TTGATGTTGGAGGTGAGGCCCGG + Intergenic
939779713 2:146430783-146430805 ATAATGTTGGAAGTGGGGCCTGG + Intergenic
939895775 2:147789665-147789687 AACTTGTTGGAGGTGGGTGCAGG - Intergenic
939939827 2:148336257-148336279 ATGTTATTGGTGGGGGTACCAGG - Intronic
940527258 2:154832166-154832188 ATAATGTTGGAGATGGGGCCCGG - Intronic
940887445 2:159001886-159001908 TTGTTGATGGAGGGAGGACCTGG + Intronic
941187331 2:162333190-162333212 ATTTTGTTGAAGGTGGGAAAGGG + Intronic
941319650 2:164039133-164039155 CTAGTGTTGGAGGTGGGGCCTGG - Intergenic
941583177 2:167325561-167325583 CCGATGTTGGAGGTGGGGCCTGG - Intergenic
942473831 2:176293443-176293465 CCGTTGTTGGAGGTGGGTCCTGG + Intronic
943402708 2:187435444-187435466 CCAGTGTTGGAGGTGGGACCTGG - Intronic
943495013 2:188609573-188609595 ACAATGTTGGAGGTGGGGCCTGG - Intergenic
943501394 2:188693726-188693748 CTATTGTTGGAGGAGGGGCCTGG - Intergenic
943702633 2:191003435-191003457 CCATTGTTGGAGGTGGGGCCTGG + Intronic
944041942 2:195365628-195365650 ATTTTGATGGAGGTGGGAGGTGG - Intergenic
944362402 2:198872906-198872928 CTAGTGTTGGAGGTGGGGCCTGG + Intergenic
944828561 2:203509720-203509742 CTAATGTTGGAGGTGGGGCCTGG + Intronic
945071450 2:205992796-205992818 ACAGTGTTGGAGGTGAGACCTGG - Intergenic
945235034 2:207625478-207625500 ACGTTGCGGGAGGGGGGACCGGG + Intronic
945328681 2:208514574-208514596 ATGTTGAATGAGGTGGGGCCTGG - Intronic
945410412 2:209499911-209499933 CTATTGTTGGAGGTGGGGCCTGG - Intronic
945957785 2:216102085-216102107 CTGGTGGTGGAGGTGGGACGAGG + Exonic
945994064 2:216421166-216421188 ATTTTGTCGGAGGTGGGGCTTGG + Intronic
946392813 2:219426550-219426572 AAGGTGCTGGAGGTGGGAGCAGG + Exonic
946816980 2:223589175-223589197 CCAGTGTTGGAGGTGGGACCTGG + Intergenic
946869954 2:224076145-224076167 CCATTGTTGGAGGTGGGGCCTGG + Intergenic
947069532 2:226272044-226272066 ATGTGCTTGGAGGTGTGAACAGG - Intergenic
947293170 2:228599976-228599998 CAAGTGTTGGAGGTGGGACCTGG - Intergenic
948030676 2:234814925-234814947 CTGGGGTTGGAGGTGGGGCCTGG + Intergenic
948046333 2:234948171-234948193 CCAATGTTGGAGGTGGGACCTGG - Intergenic
948224736 2:236300028-236300050 CTGGTATTGGAGGTGGGGCCTGG + Intergenic
948700726 2:239757943-239757965 CCGGTGTTGGAGGTGGGGCCTGG + Intergenic
1168905526 20:1400560-1400582 ATTTTGTTTGAGGTGGTAACTGG - Intergenic
1169267391 20:4174914-4174936 CTGTTGTGGGTGGGGGGACCTGG - Intronic
1169763890 20:9128052-9128074 CCATTGTTGGAGGTGGGGCCTGG + Intronic
1170081505 20:12481867-12481889 TTAATGTTGGAGGTGGGGCCTGG + Intergenic
1170109859 20:12793355-12793377 CTGATGTTGGAAGTGGGGCCTGG - Intergenic
1170406577 20:16044322-16044344 CTAATGTTGGAGGTGGGGCCTGG - Intronic
1170592332 20:17780275-17780297 CTGATGTTGGAGGTTGGGCCTGG + Intergenic
1170665745 20:18384664-18384686 AGGTTTGGGGAGGTGGGACCAGG - Intronic
1171354558 20:24534144-24534166 CTAGTGTTGGAGGTGGGGCCGGG - Intronic
1171488843 20:25502592-25502614 CCGATGTTGGAGGTGGGGCCTGG + Intronic
1173011494 20:39187159-39187181 ACAGTGTTGGAGGTGGGGCCTGG + Intergenic
1173399156 20:42709289-42709311 CCAGTGTTGGAGGTGGGACCTGG + Intronic
1173472512 20:43334763-43334785 CCAGTGTTGGAGGTGGGACCTGG + Intergenic
1173529011 20:43754316-43754338 CTGGGGTTGGAGGTGGGGCCTGG - Intergenic
1173734795 20:45352274-45352296 CTAATGTTGGAGGTGGGGCCTGG + Intergenic
1173909760 20:46657929-46657951 CTAATGTTGGAGGTGGGGCCTGG - Intronic
1173957980 20:47049407-47049429 ACATTGTTGGAGGTGGGGCCTGG + Intronic
1174060548 20:47829912-47829934 CTGATGTTGGAGGTGGGGCCTGG - Intergenic
1174071350 20:47901458-47901480 CTGATGTTGGAGGTGGGGCCTGG + Intergenic
1174086269 20:48010135-48010157 CCATTGTTGGAGGTGGGGCCTGG - Intergenic
1174099747 20:48118283-48118305 CTGATGCTGGAGGTGGGGCCTGG - Intergenic
1174152704 20:48497203-48497225 CTGATGTTGGAGGTGGGGCCTGG - Intergenic
1174663547 20:52236307-52236329 CCATTGTTGGAGGTGGGGCCTGG + Intergenic
1174679618 20:52393686-52393708 CCAGTGTTGGAGGTGGGACCTGG + Intergenic
1174988287 20:55480532-55480554 CCATTGTTGGAGGTGGGGCCTGG + Intergenic
1175274940 20:57761993-57762015 CTGATGTTGGAGGAGGGGCCTGG - Intergenic
1175294577 20:57899653-57899675 GTGGTGTTGGAGGTGGGGCCTGG - Intergenic
1175653125 20:60746172-60746194 CTGTTGTTGGGAGAGGGACCTGG - Intergenic
1175661452 20:60816436-60816458 CTGGTGTTGGAGGTGGGGCCTGG + Intergenic
1175872274 20:62214144-62214166 ACGTTGGGGGAGGTGGCACCTGG + Intergenic
1175971327 20:62688061-62688083 AAGTTGGTGGTGCTGGGACCTGG - Intergenic
1176848403 21:13894145-13894167 TTAATGTTGGAGGTGGGGCCTGG - Intergenic
1176886748 21:14265674-14265696 CCAGTGTTGGAGGTGGGACCTGG + Intergenic
1176913336 21:14595163-14595185 CTGGTGTTGTAGGTGGGGCCTGG - Intronic
1176944205 21:14958515-14958537 ATGTTGTTGGGGGTGGGGAATGG + Intergenic
1177147750 21:17425011-17425033 CTGATGTTGGAGGTGGAGCCTGG + Intergenic
1177450810 21:21262986-21263008 ATGTTGTTGTGGGAGTGACCCGG - Intronic
1177515789 21:22149053-22149075 CTAATGTTGGAGGTGGGGCCTGG + Intergenic
1177587890 21:23122512-23122534 ATGTTGTTAAGGGCGGGACCAGG + Intergenic
1178052500 21:28763515-28763537 ACACTGTTGGAGGTGGGGCCTGG - Intergenic
1178077828 21:29028723-29028745 ATGTTGTTGAAGGTCGGGCGCGG - Intronic
1178391388 21:32201260-32201282 CCGATGTTGGAGGTGGGGCCTGG - Intergenic
1178730246 21:35095363-35095385 CTGATGTTGGAAGTGGGGCCTGG - Intronic
1178739772 21:35187712-35187734 GTGTTGTTGGAAGTCGGATCAGG + Intronic
1179083370 21:38194115-38194137 CCAGTGTTGGAGGTGGGACCTGG + Intronic
1179178449 21:39025636-39025658 CAGATGTTGGAGGTGGGGCCTGG - Intergenic
1179396536 21:41045449-41045471 ATGTTAATGAAGGTGGGACTAGG + Intergenic
1179432754 21:41335351-41335373 CTGTTGTTGGAGGTGGGGCATGG + Intronic
1180234592 21:46450128-46450150 CTAATGTTGGAGGTGGGACCTGG + Intergenic
1181061841 22:20285485-20285507 GTGTTGGGGGAGGTGGGTCCAGG + Intergenic
1181377682 22:22473060-22473082 ATGTTAGTTGAGGTGGGACAGGG + Intergenic
1181506603 22:23362596-23362618 CTAATGTTGGAGGTGGGGCCTGG + Intergenic
1181571028 22:23767873-23767895 ATGGTGGCGGCGGTGGGACCCGG + Exonic
1181869697 22:25887970-25887992 ATGGTGTTTGGGGTGTGACCTGG + Intronic
1182253741 22:29023010-29023032 AATTTGTTGGAGGTGGGAGGGGG - Intronic
1182789451 22:32937683-32937705 CCGCTGTTGGAGGTGGGGCCTGG - Intronic
1182908279 22:33957499-33957521 CAAGTGTTGGAGGTGGGACCTGG + Intergenic
1183041279 22:35179986-35180008 CTAGTGTTGGAGGTGGGGCCTGG - Intergenic
1184550427 22:45201473-45201495 CTGTGGCTGGAGGTGGCACCCGG + Intronic
1184888534 22:47364706-47364728 CTAATGTTGGAGGTGGGGCCTGG - Intergenic
949381749 3:3454500-3454522 CTAGTGTTGGAGGTGGGGCCTGG - Intergenic
949413699 3:3794315-3794337 CTAATGTTGGAGGTGGGGCCTGG - Intronic
949521198 3:4855655-4855677 CTGTTGTTGAAGGTGGGACCTGG + Intronic
949830427 3:8208556-8208578 CTAGTGTTGGAGGTGGGGCCTGG - Intergenic
949913959 3:8942151-8942173 CCAGTGTTGGAGGTGGGACCTGG + Intronic
950215786 3:11157602-11157624 ATGCTGTCGGAGGGGGGGCCAGG + Intronic
950399505 3:12759563-12759585 ATGTGGGTGGAGGGGGTACCTGG - Intronic
950771597 3:15315700-15315722 ATGTTCTAGGAGGTGGAACTGGG - Intronic
950861449 3:16150868-16150890 CTGGTGTTGGAGGTGGGGCCTGG + Intergenic
951503284 3:23414490-23414512 CCATTGTTGGAGGTGGGGCCTGG - Intronic
952546075 3:34420824-34420846 CTGATGTTGGAGGTGGGGCCTGG + Intergenic
952620101 3:35327932-35327954 CCGATGTTGGAGGTGGGTCCTGG - Intergenic
954044225 3:47915768-47915790 AAGGTGTTGGAGGTGGGAGGAGG + Intronic
954147684 3:48642341-48642363 ATGCTGGTGGAGTTGGGGCCTGG - Exonic
954212900 3:49108428-49108450 ATGTTGCTGTAGGTGGGGGCTGG + Intronic
954815163 3:53274429-53274451 TTGATGTTGGAGGTGGGTCCTGG - Intergenic
954948661 3:54449554-54449576 CCATTGTTGGAGGTGGGGCCTGG + Intronic
955659242 3:61278828-61278850 GAGGTGTTGGAGGTGGGGCCTGG + Intergenic
956214464 3:66834077-66834099 CCAGTGTTGGAGGTGGGACCTGG - Intergenic
956525742 3:70158216-70158238 TGGTTGCTGGAGGTGGGAGCAGG - Intergenic
957273880 3:78065226-78065248 CCAGTGTTGGAGGTGGGACCTGG + Intergenic
957847438 3:85755804-85755826 CTGGTGTTGGAGGAGGGACCTGG - Intronic
957914283 3:86666842-86666864 CTGATTTTGGAGGTGGGGCCTGG + Intergenic
958023230 3:88021371-88021393 CTGGTGTTGGAGGTGGTGCCTGG + Intergenic
958558104 3:95705499-95705521 TCATTGTTGGAGGTGGGTCCTGG + Intergenic
958721317 3:97847171-97847193 CTGATGTTGGAGGTGGGGCCTGG - Intronic
958925208 3:100149926-100149948 ATGTGGTTGGAGGAGGGATAGGG - Intronic
959201137 3:103249355-103249377 AAGTTCTTGGAGTTGGGAGCAGG + Intergenic
959426879 3:106201252-106201274 CTCGTGTTGGAGGTGGGGCCTGG + Intergenic
959439085 3:106354505-106354527 CCAGTGTTGGAGGTGGGACCGGG + Intergenic
959542266 3:107553546-107553568 AGTTTGTGGGAGGAGGGACCTGG + Intronic
959935149 3:112021516-112021538 TTAAAGTTGGAGGTGGGACCTGG + Intergenic
959935406 3:112023447-112023469 TTGGAGTTGGAGGTGGGGCCTGG + Intergenic
960345252 3:116522513-116522535 CTAGTGTTGGAGGTGGGGCCTGG + Intronic
960462324 3:117951691-117951713 GAATTGTTGGAGGAGGGACCTGG + Intergenic
960724609 3:120658000-120658022 CTAATGTTGGAGGTGGGGCCTGG - Intronic
961663217 3:128481347-128481369 ATGTTGCTGGAGGAAGGAACTGG - Intronic
961764988 3:129203095-129203117 CTAATGTTGGAGGTGGGGCCTGG + Intergenic
962161837 3:133009235-133009257 TCAGTGTTGGAGGTGGGACCTGG + Intergenic
962665632 3:137651097-137651119 ACACTGTTGGAGGTGGGAACTGG - Intergenic
962716244 3:138128591-138128613 CCATTGTTGGAGGTGGGGCCTGG - Intronic
963553723 3:146758990-146759012 CCGATGTTGGAGGTGGGGCCTGG + Intergenic
963583800 3:147159483-147159505 TCAATGTTGGAGGTGGGACCTGG - Intergenic
963745070 3:149117519-149117541 ATGTTGTTGAAGGGTGGACTGGG - Intergenic
963803172 3:149697545-149697567 CCGGTGTTGGTGGTGGGACCTGG - Intronic
964241519 3:154600605-154600627 CCAGTGTTGGAGGTGGGACCTGG - Intergenic
964421272 3:156505985-156506007 ACAATGTTGGAGGTGGGTCCAGG - Intronic
964847495 3:161059691-161059713 CCATTGTTGGAGGTGGGGCCTGG + Intronic
965134229 3:164740919-164740941 AATATGTTGGAGGTGGGGCCTGG - Intergenic
965396879 3:168170495-168170517 CCAGTGTTGGAGGTGGGACCTGG - Intergenic
965459297 3:168941988-168942010 ATGTTGTTGGAAATGGGAAGAGG + Intergenic
965865222 3:173197467-173197489 CTAGTGTTGGAGGTGGGGCCTGG - Intergenic
965891532 3:173519937-173519959 GAAGTGTTGGAGGTGGGACCTGG + Intronic
965968499 3:174525561-174525583 TCAATGTTGGAGGTGGGACCTGG - Intronic
966241215 3:177757160-177757182 CTATTGTTTGAGGTGGGGCCTGG - Intergenic
966342949 3:178945727-178945749 CCAATGTTGGAGGTGGGACCTGG - Intergenic
966425166 3:179773094-179773116 GCAGTGTTGGAGGTGGGACCTGG + Intronic
966425532 3:179776045-179776067 CCAATGTTGGAGGTGGGACCTGG - Intronic
966782125 3:183592945-183592967 CTGGTGTTGGAGGTGGGGCCTGG + Intergenic
966925227 3:184640239-184640261 AGCTTGCTGGAGGTGGCACCTGG - Intronic
967014346 3:185468123-185468145 CTACTGTTGGAGGTGGGGCCTGG - Intronic
967646855 3:191935279-191935301 CTGGTGTTGGAGGTGGGGCCTGG + Intergenic
967686300 3:192420443-192420465 CCAATGTTGGAGGTGGGACCTGG + Intronic
968440013 4:618573-618595 CTGATGTTGGACGTGGGGCCTGG - Intergenic
968542588 4:1175539-1175561 ATGTGGGTGGTGGTGGGCCCAGG + Intronic
968929312 4:3570149-3570171 ATCTTGGTGGAGGTGGGCACAGG + Intergenic
968972886 4:3805163-3805185 CCGATGTTGGAGGTGGGGCCTGG + Intergenic
969142668 4:5092815-5092837 CCATTGTTGGAGGTGTGACCGGG - Intronic
969507774 4:7598801-7598823 ATGGTGTTGGGGGTGGGGACAGG + Intronic
970151982 4:13099413-13099435 ACACTGTTGGAGGTGGGGCCCGG - Intergenic
970792633 4:19876660-19876682 CTGATATTGGAGGTGTGACCTGG - Intergenic
971222229 4:24718877-24718899 CCATTGTTGGAGGTGGGGCCTGG - Intergenic
971279514 4:25231228-25231250 GTGTTGTGGGAGGTGGGAGGTGG - Intronic
971550757 4:27953070-27953092 CTGGTGTTGGAGGTGAGGCCTGG - Intergenic
971748057 4:30610879-30610901 ACAGTGTTGGAGGTGGGACTTGG - Intergenic
971835817 4:31761518-31761540 CCAGTGTTGGAGGTGGGACCTGG - Intergenic
971916470 4:32876033-32876055 AATCTGTGGGAGGTGGGACCAGG - Intergenic
971933472 4:33117141-33117163 GCGATGTTGGAGGTGGGGCCTGG - Intergenic
972197706 4:36674063-36674085 CCAGTGTTGGAGGTGGGACCTGG - Intergenic
972405914 4:38746607-38746629 CTAGTGTTGGAGGTGGGGCCTGG + Intergenic
972641162 4:40926398-40926420 GAGTTGTTGGAGGTGGGAATGGG - Intronic
972754554 4:42032219-42032241 CAATTGTTGGAGGTGGGGCCTGG - Intronic
972769634 4:42185135-42185157 CCATTGTTGGAGGTGGGGCCTGG + Intergenic
973046688 4:45542295-45542317 TCGATGTTGGAGGTGGGGCCTGG + Intergenic
973542378 4:51947190-51947212 CCAGTGTTGGAGGTGGGACCTGG + Intergenic
974570606 4:63642460-63642482 ATGTAGTTGGAGTTGGGCCTTGG + Intergenic
975658553 4:76665765-76665787 AAGTTGATGGAGCTAGGACCTGG + Intronic
976116711 4:81735774-81735796 CTAGTGTTGGAGGTGGGGCCTGG - Intronic
976125031 4:81824890-81824912 ATGTGTTTGGAGGTGGGTTCTGG - Intronic
976536295 4:86221819-86221841 CTAGTGTTGGAGGTGGGACTTGG + Intronic
976550451 4:86389045-86389067 CCAGTGTTGGAGGTGGGACCTGG + Intronic
976796249 4:88936561-88936583 CTGGTGTTGGAGCTGGGGCCTGG - Intronic
977178733 4:93846600-93846622 CCAATGTTGGAGGTGGGACCTGG + Intergenic
977580012 4:98714634-98714656 CTATTGTTGGGGGAGGGACCTGG - Intergenic
977801893 4:101244232-101244254 ATATTATTGGAGGTTGGTCCTGG - Intronic
978063167 4:104364029-104364051 CAGGTGTTGGAGGTGGGGCCTGG + Intergenic
978174913 4:105718240-105718262 ATGTTGTTGGAGGTGGGACCTGG + Intronic
978742327 4:112151088-112151110 ACAGTGTTGGAGGTGGGATCTGG + Intronic
978923432 4:114215173-114215195 CCAGTGTTGGAGGTGGGACCTGG - Intergenic
979027455 4:115595835-115595857 CTAATGTTGGAGGTGGGGCCTGG + Intergenic
979227602 4:118306665-118306687 ATAATATTGGAGGTGGGATCTGG - Intronic
979658381 4:123223685-123223707 CTAGTGTTGGAGGTGGGGCCTGG - Intronic
979703209 4:123690609-123690631 CTAGTGTTGGAGGTGGGGCCTGG - Intergenic
980384108 4:132063471-132063493 CCAGTGTTGGAGGTGGGACCTGG - Intergenic
980482419 4:133404168-133404190 AGGCTGTTGGAGGTGGGGCCTGG - Intergenic
980539134 4:134170742-134170764 CTAGTGTTGGAGGTGGGACCCGG - Intergenic
980811137 4:137882043-137882065 CCAGTGTTGGAGGTGGGACCTGG - Intergenic
981352570 4:143749979-143750001 ACAATGTTGGAGGTGGGGCCTGG + Intergenic
981673414 4:147313369-147313391 AAGTTTCTGGAGGTTGGACCAGG - Intergenic
982390793 4:154862169-154862191 TTAGTGTTGGAGGTGGGGCCTGG - Intergenic
982567017 4:156998174-156998196 TCATTGTTGGAGGTGGGGCCTGG - Intergenic
982607659 4:157535623-157535645 ACATTGTTGGAGGAGGGACCTGG + Intergenic
982727379 4:158919943-158919965 AACTTGTTGGAGGTGGGGCCTGG + Intronic
983075059 4:163316259-163316281 ACAGTGTTGGAGGTGGGGCCTGG - Intergenic
983154535 4:164329874-164329896 CTATTGTTGGAGGTGGGGCCTGG - Intronic
983195164 4:164798777-164798799 CCGTTGTTGAAGGTGGGGCCCGG + Intergenic
983375227 4:166918786-166918808 CCATTGTTGGAGGTGGGGCCTGG + Intronic
983378971 4:166967408-166967430 ATAATGTTGGGGGAGGGACCTGG + Intronic
983921533 4:173350987-173351009 CCATTGTTGGAGGTGGGGCCTGG - Intergenic
984035947 4:174667935-174667957 CTGGTGTTGGAGGTGGGGCTTGG + Intronic
984599716 4:181712253-181712275 CTGATGTTGGAGGTGGATCCTGG + Intergenic
985007652 4:185550068-185550090 CCAATGTTGGAGGTGGGACCTGG - Intergenic
985114401 4:186576576-186576598 TCATTGTTGGAGGTGGGGCCCGG - Intergenic
985309102 4:188577700-188577722 CTGACGTTGGAGGTGGGGCCTGG - Intergenic
986694426 5:10339361-10339383 TTGCTGTTGGAGGTGGGGGCTGG + Intergenic
986861827 5:11935698-11935720 TCGATGTTGGAGGAGGGACCTGG - Intergenic
986881953 5:12185102-12185124 CCAATGTTGGAGGTGGGACCTGG - Intergenic
987229812 5:15882163-15882185 CCATTGTTGGAGGTGGGGCCTGG - Intronic
987246632 5:16055486-16055508 ATATAGTTGGAGGTGGGGTCTGG - Intergenic
987393283 5:17397184-17397206 CTGGTGTTGGAGGTGGGGCCTGG - Intergenic
987476936 5:18402056-18402078 CTGATGTTGGAGGTGGCGCCTGG + Intergenic
987859000 5:23459455-23459477 CCATTGTTGGAGGTGGGGCCTGG - Intergenic
988187171 5:27880999-27881021 CCAGTGTTGGAGGTGGGACCTGG + Intergenic
988436138 5:31177611-31177633 TCAGTGTTGGAGGTGGGACCTGG + Intergenic
988517605 5:31918201-31918223 CCATTGTTGGAGGAGGGACCTGG - Intronic
988791283 5:34610166-34610188 CTAATGTTGGAGGTGGGGCCCGG + Intergenic
989087893 5:37695295-37695317 ACAATGTTGGAGGTGGGACTTGG - Intronic
989108434 5:37885297-37885319 CTAATGTTGGAGGTGGGACCTGG + Intergenic
990622486 5:57575966-57575988 CTGGTGTTGGAGGAGGGGCCCGG + Intergenic
990635356 5:57719929-57719951 ATGATGTTGGATATTGGACCAGG - Intergenic
990940999 5:61203046-61203068 CCAGTGTTGGAGGTGGGACCTGG + Intergenic
991042911 5:62194069-62194091 TCAATGTTGGAGGTGGGACCTGG + Intergenic
991522396 5:67515433-67515455 CTAGTGTTGGAGGTGGGGCCTGG + Intergenic
992376314 5:76191259-76191281 CCAATGTTGGAGGTGGGACCTGG - Intronic
992410003 5:76495894-76495916 CCGGTGTTGGAGGTGGGGCCTGG - Intronic
992534120 5:77681323-77681345 GTGTTGTTGTGGGAGGGACCAGG - Intergenic
992721082 5:79561826-79561848 CTAGTGTTGGAGGTGGGGCCTGG - Intergenic
992977131 5:82132082-82132104 CTAATGTTGGAGGTGGGTCCTGG - Intronic
993205011 5:84867840-84867862 CTGATGTTGGAGGTGGGGACTGG + Intergenic
993388730 5:87291569-87291591 CTAATGTTGGAGGTGGGACCTGG + Intronic
994270889 5:97775045-97775067 ATGTTGTTGGCTGTGGGCCATGG - Intergenic
994507857 5:100664811-100664833 CTAGTGTTGGAGGTGGGGCCTGG - Intergenic
994509975 5:100690166-100690188 ATGGTGGTGGAGGTGGGGCGGGG + Intergenic
994653215 5:102555991-102556013 CTAGTGTTGGAGGTGGGACCTGG - Intergenic
994740349 5:103610297-103610319 CTAATGTTGGAGGTGGGCCCTGG + Intergenic
995561648 5:113388427-113388449 ACAATGTTGGAGGTGGGGCCTGG + Intronic
995649002 5:114346287-114346309 GAGATGTTGGAGGTGGGGCCTGG - Intergenic
996253178 5:121363759-121363781 GTTTTGTTGGAGTTGGGGCCTGG - Intergenic
997046805 5:130329082-130329104 CTAGTGTTGGAGGTGGGACCTGG + Intergenic
997955830 5:138277935-138277957 CTAATGTTGGAGGTGGGGCCTGG + Intergenic
998558215 5:143146771-143146793 ATGGAATTGGAGGTGGGACATGG + Intronic
998767327 5:145502375-145502397 CTCGTGTTGGAGGTGGGGCCTGG - Intronic
999921689 5:156328662-156328684 TTGTACTTGGAGGAGGGACCTGG + Intronic
999986384 5:157009241-157009263 CTAATGTTGGAGGTGGGGCCTGG - Intergenic
1000106723 5:158066891-158066913 TCATTGTTGGAGGTGGGGCCTGG - Intergenic
1000269604 5:159671475-159671497 CTGATGTTGAAGGTGGGGCCTGG + Intergenic
1000401973 5:160838811-160838833 CCAGTGTTGGAGGTGGGACCTGG + Intronic
1000561260 5:162792131-162792153 CCAGTGTTGGAGGTGGGACCCGG - Intergenic
1001666772 5:173439687-173439709 ACAATGTTGGAGGTGGGGCCTGG - Intergenic
1002018381 5:176344777-176344799 CTGATGTTGGAGGTGGGGCCTGG - Intronic
1002098590 5:176846323-176846345 AGGTTGTAGGAGGTGGAGCCAGG + Intronic
1002296536 5:178234428-178234450 ATATAGTTGGAGGTCAGACCAGG + Intergenic
1002902088 6:1417660-1417682 ATGCAGTTGGAGCTGGGACATGG - Intergenic
1003152772 6:3566545-3566567 CTGGTGTTGGAGGTGGGGCCTGG + Intergenic
1003558417 6:7161141-7161163 TTTATGTTTGAGGTGGGACCAGG + Intronic
1003697763 6:8428150-8428172 TTGTTGTTGGAGGTGGGGCTTGG - Intronic
1004027577 6:11834017-11834039 CCCTTGTTGGAGGTGGGGCCTGG - Intergenic
1004165750 6:13255319-13255341 CCAGTGTTGGAGGTGGGACCTGG - Intronic
1004201128 6:13549075-13549097 GGGATGTTGGAGGAGGGACCTGG + Intergenic
1004248013 6:13998785-13998807 CTGATGTTGGAGGTGGAGCCTGG - Intergenic
1004323822 6:14655109-14655131 CTGATGTTGGAGGTGGGGTCTGG - Intergenic
1004351512 6:14894081-14894103 CTGATGTTGGAGATGGGGCCTGG - Intergenic
1004394271 6:15234414-15234436 ATATTTTTGAAGGTGAGACCAGG - Intergenic
1004733690 6:18383965-18383987 TCATTGTTGGAGGTGGGGCCTGG + Intergenic
1004733777 6:18384624-18384646 CCGATGTTGGAGGTGGGGCCTGG + Intergenic
1005101999 6:22181531-22181553 CTAATGTTGGAGGTGGGGCCTGG - Intergenic
1007889917 6:45279403-45279425 CTAATGTTGGAGGTGGGGCCTGG + Intronic
1008976862 6:57437272-57437294 CCATTGTTGGAGGTGGAACCTGG - Intronic
1009165002 6:60330209-60330231 CCATTGTTGGAGGTGAGACCTGG - Intergenic
1009615028 6:65992666-65992688 CTAGTGTTGGAGGTGGGGCCAGG - Intergenic
1010630038 6:78188582-78188604 ATAATGTTGGAGGTGTGGCCTGG - Intergenic
1011041386 6:83033447-83033469 CTAATGTTGGAGGTGGGACCTGG + Intronic
1011245378 6:85316593-85316615 CCAATGTTGGAGGTGGGACCTGG + Intergenic
1011257916 6:85442772-85442794 GTGTTGTTGGAGGTGAGGCCTGG - Intergenic
1011841680 6:91508671-91508693 CCATTGTTGGAGGTGGGGCCTGG + Intergenic
1012017800 6:93874206-93874228 CTAATGTTGGAGGTGGGGCCTGG + Intergenic
1012215448 6:96577154-96577176 ATGATGTTGGTGGTGGGAGTTGG - Intronic
1012528395 6:100204773-100204795 CAAATGTTGGAGGTGGGACCTGG - Intergenic
1012593348 6:101010718-101010740 GCGATGTTGGAGGTGGGGCCTGG + Intergenic
1013472743 6:110479123-110479145 CTAATGTTGGAGGTGGGGCCTGG + Intergenic
1013486725 6:110603909-110603931 CCAGTGTTGGAGGTGGGACCTGG + Intergenic
1013549968 6:111197917-111197939 CCAATGTTGGAGGTGGGACCTGG - Intronic
1013611706 6:111802103-111802125 CAGATGTTGGAGGTGGGGCCTGG + Intronic
1014395389 6:120922063-120922085 ACAGTGTTGGAGGTGGGACCTGG - Intergenic
1014893651 6:126873009-126873031 CCAGTGTTGGAGGTGGGACCTGG + Intergenic
1015196426 6:130529011-130529033 CCAGTGTTGGAGGTGGGACCTGG + Intergenic
1015804132 6:137091648-137091670 CCGATGTTGGAGGTGGGGCCTGG + Intergenic
1015907394 6:138130876-138130898 TCAGTGTTGGAGGTGGGACCTGG - Intergenic
1016237588 6:141887214-141887236 CTAGTGTTGGAGGTGGGACCTGG - Intergenic
1016533616 6:145086494-145086516 ACATTGTTGGAGGTGGGGCCTGG - Intergenic
1016564233 6:145434852-145434874 CTAATGTTGGAGGTGGGGCCTGG + Intergenic
1016693568 6:146966272-146966294 TCAATGTTGGAGGTGGGACCTGG + Intergenic
1016877080 6:148876316-148876338 TCGGTGTTGGAGGTGGGGCCTGG - Intronic
1016927281 6:149363320-149363342 CTATTGTTGGAGGTGAGGCCTGG - Intronic
1017018975 6:150125003-150125025 ACAGTGTTGGAGGTGGGACTCGG + Intergenic
1017063003 6:150503918-150503940 CCATTGTTGGAGGTGGGGCCTGG - Intergenic
1017234912 6:152109202-152109224 CTAGTGTTGGAGGTGGGGCCTGG - Intronic
1017371605 6:153716011-153716033 GTGTAGTTGGAGGTGGGGACAGG - Intergenic
1017407735 6:154138417-154138439 AAGTATCTGGAGGTGGGACCTGG + Intronic
1017444356 6:154493877-154493899 TTAATGTTGGAGGAGGGACCTGG - Intronic
1017458323 6:154623708-154623730 CTAGTGTTGGAGGTGGGGCCTGG - Intergenic
1017469606 6:154726596-154726618 CCAATGTTGGAGGTGGGACCTGG - Intergenic
1017687759 6:156930161-156930183 TTAATGTTGGAGGTGGGGCCAGG + Intronic
1018004957 6:159613114-159613136 TTAGTGTTGGAGGTGGGACCTGG - Intergenic
1018419068 6:163626388-163626410 CCGGTGTTGGAGGTGGGGCCTGG - Intergenic
1018464548 6:164031784-164031806 CTAATGTTGGAGGTGGGGCCTGG + Intergenic
1018586063 6:165360536-165360558 ATGTTGTAGGAGGAGGCAACTGG + Intronic
1018852980 6:167654531-167654553 ATGTTACTGGAGGTGAGAGCAGG - Intergenic
1019005634 6:168794339-168794361 AAGGTGTGGGAGGTTGGACCTGG - Intergenic
1020035312 7:4960043-4960065 AGGTTGGTGGAGGTGGGAAATGG + Intergenic
1020346690 7:7173107-7173129 CCAATGTTGGAGGTGGGACCTGG + Intronic
1020474669 7:8581554-8581576 CTGATGTTGGAGGAGGGGCCTGG - Intronic
1020533892 7:9369771-9369793 CAAGTGTTGGAGGTGGGACCTGG - Intergenic
1020629195 7:10620138-10620160 TCAGTGTTGGAGGTGGGACCTGG - Intergenic
1020973363 7:14976004-14976026 CTGCTGTTGGAGGTGGGGCCTGG - Intergenic
1021758785 7:23882769-23882791 CCAGTGTTGGAGGTGGGACCTGG - Intergenic
1021792814 7:24223388-24223410 CTAATGTTGGAGGTGGGGCCTGG - Intergenic
1022421875 7:30230890-30230912 CTAATGTTGGAGGTGGGACCTGG + Intergenic
1022513666 7:30961637-30961659 GCATTGTTGGAGGTGGGGCCTGG + Intronic
1022623740 7:32012452-32012474 CTAGTGTTGGAGGTGGGGCCTGG - Intronic
1022886634 7:34653474-34653496 CTAATGTTGGAGGTGGGGCCTGG - Intergenic
1023854698 7:44175605-44175627 CTTATGTTGGAGGTGGGGCCTGG - Intronic
1024766238 7:52664337-52664359 CTGGTGTTGGAGTAGGGACCTGG + Intergenic
1024839641 7:53570830-53570852 CCGGTGTTGGAGGTGGGCCCTGG + Intergenic
1024947856 7:54829301-54829323 CCAATGTTGGAGGTGGGACCTGG + Intergenic
1025006560 7:55360258-55360280 CCATTGTTGGAAGTGGGACCTGG - Intergenic
1025234390 7:57224111-57224133 CTGATGTTGGAGGTGGGGCGTGG + Intergenic
1025244777 7:57308824-57308846 CTGTTGTGGGAGCTGGGAGCCGG + Intergenic
1025773523 7:64536582-64536604 TTAATGTTGGATGTGGGACCTGG - Intronic
1025939978 7:66068812-66068834 CCGATGTTGGAGGTGGGCCCTGG - Intergenic
1025980191 7:66398986-66399008 CTAATGTTGGAGGTGGGGCCTGG + Intronic
1026292202 7:69017902-69017924 CTAGTGTTGGAAGTGGGACCTGG - Intergenic
1026352967 7:69533684-69533706 CCGATGTTGGAGGTGGGGCCTGG + Intergenic
1026354065 7:69542064-69542086 CCAGTGTTGGAGGTGGGACCTGG - Intergenic
1026558181 7:71426115-71426137 CTAGTGTTGGAGGTGGGGCCTGG - Intronic
1026655181 7:72250562-72250584 CTGGTGTTGGAGGTGGGGTCTGG + Intronic
1026769607 7:73187101-73187123 ATGGAGTGGGAGGTGGCACCTGG + Intergenic
1027010476 7:74740487-74740509 ATGGAGTGGGAGGTGGCACCTGG + Intronic
1027077566 7:75205557-75205579 ATGGAGTGGGAGGTGGCACCTGG - Intergenic
1027121390 7:75524724-75524746 CCAATGTTGGAGGTGGGACCTGG + Intergenic
1027771968 7:82418276-82418298 GTGTTGTGGTAGGGGGGACCAGG - Intronic
1028014355 7:85687841-85687863 TCATTGTTGGAGGTGGGGCCTGG + Intergenic
1028792172 7:94865416-94865438 CCAGTGTTGGAGGTGGGACCTGG + Intergenic
1029207313 7:98877744-98877766 AAGGTGTAGGAGGTGGAACCAGG + Intergenic
1029473327 7:100768065-100768087 ATGTTGGGGGAGCTGGGACCAGG - Intronic
1030188662 7:106789494-106789516 CCCATGTTGGAGGTGGGACCTGG + Intergenic
1030746330 7:113170987-113171009 CCGGTGTTGGAGGTGGGGCCTGG + Intergenic
1030882667 7:114900683-114900705 CCAATGTTGGAGGTGGGACCTGG - Intergenic
1031719421 7:125152733-125152755 CTAATGTTGGAGGTGGGGCCTGG + Intergenic
1031760238 7:125705098-125705120 CCCTTGTTGGAGGTGGGGCCTGG + Intergenic
1032474994 7:132205549-132205571 ATGTGGCTGGAGGAGGGAACTGG - Intronic
1032507603 7:132447379-132447401 ATGTCCTGGGAGGTGGGACCAGG + Intronic
1033027730 7:137792629-137792651 ACATTGTTGGAGATGGGGCCTGG + Intronic
1033313395 7:140278892-140278914 CCATTGTTGGAGGTGGGACCTGG + Intergenic
1033502673 7:141967498-141967520 TTAATGTTGGAGGTGGGGCCTGG + Intronic
1033778699 7:144644117-144644139 ATGTTGTTAGAACTGGGACTGGG - Intronic
1033828300 7:145219551-145219573 CTAATGTTGGAGGTGGGACTTGG + Intergenic
1033864219 7:145668764-145668786 CAGGTGTTGGAGGAGGGACCTGG + Intergenic
1035405727 7:158595905-158595927 CCACTGTTGGAGGTGGGACCTGG - Intergenic
1035436532 7:158863857-158863879 AGGGTGTTGGAGGGGGGAGCGGG + Intronic
1035896129 8:3404387-3404409 ACTTCTTTGGAGGTGGGACCAGG + Intronic
1036097684 8:5741760-5741782 AGCTTCATGGAGGTGGGACCAGG - Intergenic
1036957818 8:13209582-13209604 TCAGTGTTGGAGGTGGGACCTGG + Intronic
1037364163 8:18104590-18104612 CCATTGCTGGAGGTGGGACCTGG + Intergenic
1037408364 8:18567867-18567889 CCAATGTTGGAGGTGGGACCTGG + Intronic
1037460486 8:19103464-19103486 CTAATGTTGGAGGTGGGGCCTGG - Intergenic
1037941694 8:22956323-22956345 CCATTGTTGGAGGTGGGGCCTGG + Intronic
1038437616 8:27547110-27547132 ACGATGTTGGAAGTGGGGCCTGG - Intergenic
1038975229 8:32687962-32687984 CCATTGTTGGAGGTGGGACCTGG - Intronic
1039313991 8:36351735-36351757 CCAGTGTTGGAGGTGGGACCTGG - Intergenic
1039817114 8:41103912-41103934 CCAGTGTTGGAGGTGGGACCGGG - Intergenic
1040104258 8:43531568-43531590 CTAATGTTGGAGGTGGGGCCTGG + Intergenic
1040509685 8:48083334-48083356 TTGTTGTTGGGGGTGGGGCTTGG + Intergenic
1040535285 8:48303770-48303792 CCAGTGTTGGAGGTGGGACCTGG + Intergenic
1040886169 8:52266309-52266331 GTGTAGTTGGATATGGGACCAGG + Intronic
1041013963 8:53572042-53572064 CTAGTGTTGGAGGAGGGACCTGG + Intergenic
1041682058 8:60603996-60604018 CCATTGTTGGAGGTGGGGCCTGG + Intronic
1041705859 8:60845412-60845434 ATGTTATTAGAGGGTGGACCTGG + Intronic
1041760502 8:61361197-61361219 CAATTGTTGGAGGTGGGGCCTGG - Intronic
1042111993 8:65390630-65390652 CCGTTGTTGAAGGTGGGGCCTGG - Intergenic
1042543639 8:69931479-69931501 ATTTCTATGGAGGTGGGACCTGG - Intergenic
1043085659 8:75828051-75828073 CCAGTGTTGGAGGTGGGACCTGG + Intergenic
1043321816 8:78996197-78996219 CCAGTGTTGGAGGTGGGACCTGG - Intergenic
1043660461 8:82735012-82735034 GTGTTGTTGTGGGAGGGACCTGG + Intergenic
1043738736 8:83779918-83779940 TTAATGTTGGAGGTGGGGCCTGG + Intergenic
1043812485 8:84758572-84758594 ATGTGGTTGCTGGTGGGCCCTGG + Intronic
1044216945 8:89623338-89623360 CTAATGTTGGAGGTGGGACCTGG - Intergenic
1044250283 8:89998077-89998099 CTGGTGTTGGAGGTGGAGCCTGG + Intronic
1044584031 8:93852271-93852293 CCATTGTTGGAGGTGGGGCCTGG - Intergenic
1044741780 8:95335156-95335178 GTGTTGTTAGAGGTGGAAGCAGG + Intergenic
1044881386 8:96726684-96726706 CTATTGTTGGAGGTGGGGCCTGG - Intronic
1045097193 8:98810193-98810215 CCAGTGTTGGAGGTGGGACCTGG - Intronic
1045409682 8:101904488-101904510 ATGATGCTGGAGGGGAGACCAGG - Intronic
1045436892 8:102172884-102172906 TTAGTGTTGGAGGTGGGGCCTGG - Intergenic
1045438797 8:102190052-102190074 CTGATGTTGGAGGTGGGGCCTGG - Intergenic
1045466315 8:102473592-102473614 CCATTGTTGGAGGTGGGATCTGG + Intergenic
1045559124 8:103244013-103244035 GTTATGTTGGAGGTGGGACCTGG - Intergenic
1045694422 8:104792585-104792607 TTAATGTTGGAGGTGGGGCCTGG + Intronic
1045714208 8:105022515-105022537 CTGATGTTGGAGGTGGGGCCTGG - Intronic
1046134191 8:110004989-110005011 CCATTGTTGGAGGTGGGGCCTGG - Intergenic
1046311710 8:112445635-112445657 TTGATGTTGGAAGTGGGGCCTGG - Intronic
1046379678 8:113435391-113435413 ATGTTTTGGGAGGAGGGAGCTGG - Intronic
1046405142 8:113763413-113763435 CCAGTGTTGGAGGTGGGACCTGG - Intergenic
1046859853 8:119078132-119078154 CCCTTGTTGGAGGTGGGGCCTGG - Intronic
1047530245 8:125667694-125667716 CCTGTGTTGGAGGTGGGACCTGG + Intergenic
1047681452 8:127258189-127258211 CAGTTGTTGGAGGGAGGACCGGG + Intergenic
1047843887 8:128785145-128785167 CTGATGTTGGAGGTGGGGCCTGG - Intergenic
1048087543 8:131200525-131200547 TTAATGTTGGAGGTGGGGCCCGG + Intergenic
1048123887 8:131611601-131611623 CTAGTGTTGGAGGTGGGGCCTGG - Intergenic
1048392078 8:133976646-133976668 CCATTGTTGGAGGTGGGGCCCGG + Intergenic
1048917976 8:139202642-139202664 CTGGTGCTGGAGGTGGGGCCTGG - Intergenic
1049244537 8:141555085-141555107 ATGGTGTTGGAGGTGTGTCATGG + Intergenic
1049244552 8:141555182-141555204 ATGGTGTTGGAGGTGTGTCATGG + Intergenic
1049244566 8:141555260-141555282 ATGGTGTTGGAGGTGTGTCATGG + Intergenic
1049489334 8:142885876-142885898 CCAGTGTTGGAGGTGGGACCTGG + Intronic
1049534444 8:143171729-143171751 GAGCTGCTGGAGGTGGGACCCGG + Intergenic
1049552248 8:143265852-143265874 CTGATGGTGGCGGTGGGACCTGG - Intronic
1051269667 9:15343198-15343220 CTGTTGTTGGAAGTGGGGCCTGG - Intergenic
1051554247 9:18364960-18364982 CCGGTGTTGGAGGTGGGGCCTGG - Intergenic
1051586447 9:18731920-18731942 CTAATGTTGGAGGTGGGGCCTGG - Intronic
1051724088 9:20070910-20070932 CCGGTGTTGGAGGTGGGGCCCGG + Intergenic
1052880174 9:33597094-33597116 TTAATGTTGGAGGTGGGGCCTGG + Intergenic
1053272665 9:36761053-36761075 ATGTTGTTGAAGGTCGGGCAGGG + Intergenic
1053422756 9:37990247-37990269 AGGGTGTTGGAGGTGGTACAGGG + Intronic
1053433494 9:38059374-38059396 AGGATCTTGGAGGTGGGTCCAGG - Intronic
1053495801 9:38547124-38547146 TTAATGTTGGAGGTGGGGCCTGG - Intronic
1053665966 9:40317882-40317904 TTAATGTTGGAGGTGGGACCTGG + Intronic
1053915547 9:42942927-42942949 TTAATGTTGGAGGTGGGACCTGG + Intergenic
1054377122 9:64457910-64457932 TTAATGTTGGAGGTGGGACCTGG + Intergenic
1054518644 9:66058401-66058423 TTAATGTTGGAGGTGGGACCTGG - Intergenic
1055055954 9:72024272-72024294 CCAGTGTTGGAGGTGGGACCTGG - Intergenic
1055331123 9:75184785-75184807 CCATTGTTGGAGGTGGGGCCTGG - Intergenic
1055751736 9:79514005-79514027 CCATTGTTGGAGGTGGGGCCCGG - Intergenic
1055864661 9:80798266-80798288 ATGATGTTGGGGGTGGGAGAGGG + Intergenic
1055951802 9:81736214-81736236 CCAATGTTGGAGGTGGGACCTGG - Intergenic
1056191405 9:84187892-84187914 CCGGTGTTGGAGGTGGGGCCTGG - Intergenic
1056192559 9:84198734-84198756 CTAATGTTGGAGGTGGGGCCTGG - Intergenic
1056420521 9:86421798-86421820 TTAGTGTTGGAGGTGGGGCCTGG - Intergenic
1056585917 9:87926936-87926958 TTAATGTTGGAGGTGGGACCTGG - Intergenic
1056610967 9:88126007-88126029 TTAATGTTGGAGGTGGGACCTGG + Intergenic
1057956175 9:99409784-99409806 CCATTGTTGGAGGTGGGGCCTGG + Intergenic
1058749514 9:108025504-108025526 CTAATGTTGGAGGTGGGGCCTGG + Intergenic
1058918830 9:109593874-109593896 CCATTGTTGGAGGTGGGGCCTGG - Intergenic
1059098547 9:111445824-111445846 CTGTTGTGGGGGGTGGGGCCTGG - Intronic
1059330181 9:113530121-113530143 GTTTTGTGGGAGGTGGGACATGG + Intronic
1059884934 9:118735523-118735545 CTAATGTTGGAGGTGGGGCCTGG + Intergenic
1060178542 9:121515571-121515593 CCGGTGTTGGAGGTGGGGCCTGG + Intergenic
1060466934 9:123914863-123914885 CCAGTGTTGGAGGTGGGACCTGG - Intronic
1060512942 9:124247394-124247416 TTAATGTTGGAGGTGGGACAGGG + Intergenic
1061250989 9:129426271-129426293 CTGAGGTTGGAGGTGGGAACAGG + Intergenic
1061979629 9:134094145-134094167 CCGGTGTTGGAGGTGGGGCCTGG - Intergenic
1062267063 9:135691859-135691881 CCAGTGTTGGAGGTGGGACCTGG + Intergenic
1062603795 9:137333513-137333535 ACGGTGTTGGAGGTGGGGCCTGG + Intronic
1203488608 Un_GL000224v1:82554-82576 CCATTGTTGGAGGTGGGGCCTGG + Intergenic
1203501229 Un_KI270741v1:24449-24471 CCATTGTTGGAGGTGGGGCCTGG + Intergenic
1185673172 X:1827368-1827390 CTGATGTTGGAGGTGAGGCCAGG - Intergenic
1185739397 X:2518844-2518866 GTGGTGTTGGAGGTGGGGCCTGG + Intergenic
1185841557 X:3396573-3396595 CTAGTGTTGGAGGTGGGGCCTGG - Intergenic
1185866718 X:3630822-3630844 CCAGTGTTGGAGGTGGGACCTGG - Intronic
1185882201 X:3751332-3751354 ATGGTGTTGGACGAGGGGCCTGG + Intergenic
1186003766 X:5044651-5044673 ATGGTGATGGAAGTGGGGCCTGG + Intergenic
1186029786 X:5355068-5355090 CCTATGTTGGAGGTGGGACCTGG - Intergenic
1186145159 X:6617443-6617465 TTGGTGTTGGAGGTGGGGCCTGG + Intergenic
1186391554 X:9164778-9164800 TTGATGCTGGAGGTGGGGCCTGG - Intergenic
1186595882 X:10981011-10981033 CTGATGTTGGAAGTGGGGCCTGG - Intergenic
1186623160 X:11263085-11263107 CTAATGTTGGAGGTGGGGCCTGG + Intronic
1187132405 X:16515546-16515568 CTAATGTTGGAGGTGGGGCCTGG - Intergenic
1187633531 X:21201758-21201780 CTAGTGTTGGAGGTGGGGCCTGG - Intergenic
1187768312 X:22667623-22667645 CCATTGTTGGAGGTGGGGCCTGG + Intergenic
1188045332 X:25419868-25419890 CTGAAGTTGGAGGTGGGGCCAGG + Intergenic
1188191081 X:27172538-27172560 CTGATGCTGGAGGTGGGGCCTGG - Intergenic
1188495335 X:30777666-30777688 TCATTGTTGGAGGTGGGGCCTGG + Intergenic
1188671266 X:32884583-32884605 ATGTTGCTGGAATTGGAACCAGG + Intronic
1188788347 X:34376973-34376995 CTGTTGTGGGAGGGGGGAGCGGG - Intergenic
1188973505 X:36646208-36646230 CCAGTGTTGGAGGTGGGACCTGG + Intergenic
1189216842 X:39332602-39332624 CCAATGTTGGAGGTGGGACCTGG - Intergenic
1189249329 X:39587784-39587806 CTAGTGTTGGAGGTGGGGCCTGG + Intergenic
1189358002 X:40326132-40326154 ACAATGTTGGAGGTGGGGCCTGG - Intergenic
1189378357 X:40483425-40483447 CCATTGTTGGAGGTGGGGCCTGG - Intergenic
1189612100 X:42748142-42748164 CCAGTGTTGGAGGTGGGACCTGG + Intergenic
1189909342 X:45794402-45794424 GTGTGGCTGGAGGTGGGGCCAGG + Intergenic
1189973268 X:46439149-46439171 CTAATGTTGGAGGTGGGGCCTGG + Intergenic
1190132059 X:47757051-47757073 CCAATGTTGGAGGTGGGACCTGG - Intergenic
1190539650 X:51463993-51464015 ACAATGTTGGAGGTGGGGCCTGG - Intergenic
1190704668 X:53016946-53016968 CCATTGTTGGAGGTGGGGCCTGG + Intergenic
1190794607 X:53729289-53729311 CCATTGTTGAAGGTGGGACCTGG - Intergenic
1191669073 X:63732300-63732322 ATTTTATTGGAGGTGGTAGCAGG - Intronic
1191735396 X:64383760-64383782 TTGGTGTTGGAGGTGGGAACTGG - Intronic
1192512011 X:71726566-71726588 CTAATGTTGGAGGTGGGGCCTGG + Intergenic
1192514686 X:71754939-71754961 CTAATGTTGGAGGTGGGGCCTGG - Intergenic
1192527976 X:71863910-71863932 CTAATGTTGGAGGTGGGGCCTGG - Intergenic
1192660814 X:73040507-73040529 CCGATGTTGGAAGTGGGACCTGG - Intergenic
1192980462 X:76334316-76334338 CCAGTGTTGGAGGTGGGACCTGG + Intergenic
1193237693 X:79129698-79129720 CTAGTGTTGGAGGTGGGGCCTGG + Intergenic
1193873687 X:86833906-86833928 ATGTTGTTGGAGGAGGGAGGTGG - Intergenic
1194036883 X:88885936-88885958 ATGTTATTGAGGATGGGACCTGG + Intergenic
1194129356 X:90061207-90061229 CTAGTGTTGGAGGTGGGGCCTGG + Intergenic
1194192298 X:90852688-90852710 CTGATGTTGGAGTTGGGCCCTGG + Intergenic
1194313390 X:92341737-92341759 CTAATGTTGGAGGTGGGGCCTGG - Intronic
1194320979 X:92446402-92446424 ATGCTGTGGGAGGAGGAACCTGG + Intronic
1194680212 X:96843049-96843071 CCATTGTTGGAGGTGGGGCCTGG + Intronic
1194800106 X:98262567-98262589 CCATTGTTGGAGGTGGGGCCTGG - Intergenic
1195778031 X:108429358-108429380 ATGTTGTTGGAGGAGGAATATGG + Intronic
1195877893 X:109561456-109561478 ATGTGTTAGGAGGTGGGGCCTGG + Intergenic
1196231432 X:113227305-113227327 CTAATGTTGGAGGTGGGGCCTGG - Intergenic
1196278880 X:113799607-113799629 CTAATGTTGGAGGTGGGGCCTGG + Intergenic
1196496311 X:116328548-116328570 CTATTGTTGGAGCTGGGGCCTGG + Intergenic
1197311642 X:124912520-124912542 ATGGTGTTGCAGGTGGGCTCTGG - Intronic
1197357904 X:125459323-125459345 TCGATGTTGGAGGTGGGGCCTGG + Intergenic
1197385318 X:125794812-125794834 CCATTGTTGGAGGTGGGGCCTGG + Intergenic
1197413995 X:126151568-126151590 CCATTGTTGGAGGTGGGGCCTGG - Intergenic
1197813829 X:130476352-130476374 CTGATGTTGGAGGTGGGGCCTGG - Intergenic
1198049738 X:132939166-132939188 CTAATGTTGGAGGTGGGGCCTGG - Intronic
1198053956 X:132975651-132975673 CCATTGTTGGAGGTGGGGCCTGG + Intergenic
1198066885 X:133107005-133107027 ACAATGTTAGAGGTGGGACCTGG - Intergenic
1198817404 X:140607098-140607120 TTAATGTTGGAGGTGGGGCCTGG - Intergenic
1198863217 X:141092603-141092625 ATGTTGTGGGAGGGGGACCCAGG - Intergenic
1198899473 X:141494784-141494806 ATGTTGTGGGAGGGGGACCCAGG + Intergenic
1198995460 X:142568749-142568771 CCATTGTTGGAGGTGGGGCCTGG - Intergenic
1199213439 X:145240728-145240750 CCAGTGTTGGAGGTGGGACCTGG + Intergenic
1199257451 X:145732959-145732981 CTTATGTTGGAGGTGGGGCCTGG + Intergenic
1199301174 X:146215801-146215823 CCAGTGTTGGAGGTGGGACCTGG + Intergenic
1199383084 X:147193297-147193319 CTAATGTTGGAGGTGGGGCCTGG + Intergenic
1199657554 X:150011886-150011908 CTAATGTTGGAGGTGGGACCTGG - Intergenic
1199948866 X:152689526-152689548 ACAGTGTTGGAGGTGGGGCCTGG - Intergenic
1199960810 X:152778923-152778945 ACAGTGTTGGAGGTGGGGCCTGG + Intergenic
1199963030 X:152794776-152794798 CCATTGTTGGAGGTGGGGCCTGG + Intergenic
1199982591 X:152929067-152929089 ATGTTGGTGGGGGTGGGAGGAGG + Intronic
1200538933 Y:4435138-4435160 CTGATGTTGGAGTTGGGCCCTGG + Intergenic
1200621654 Y:5455860-5455882 CTAATGTTGGAGGTGGGGCCTGG - Intronic
1200629094 Y:5559549-5559571 ATGTTGTGGGAGGAGGAACCTGG + Intronic
1201547222 Y:15178856-15178878 TCAGTGTTGGAGGTGGGACCTGG - Intergenic
1201791807 Y:17849075-17849097 ATTTTGTTTGAGGTGGTAACTGG + Intergenic
1201809747 Y:18056914-18056936 ATTTTGTTTGAGGTGGTAACTGG - Intergenic
1202254854 Y:22910430-22910452 ATGTTGTTGAACATGGCACCTGG + Intergenic
1202336898 Y:23821391-23821413 ATTTTGTTTGAGGTGGTATCTGG + Intergenic
1202353411 Y:24018731-24018753 ATTTTGTTTGAGGTGGTAACTGG + Intergenic
1202407845 Y:24544179-24544201 ATGTTGTTGAACATGGCACCTGG + Intergenic
1202462937 Y:25125902-25125924 ATGTTGTTGAACATGGCACCTGG - Intergenic
1202517368 Y:25651384-25651406 ATTTTGTTTGAGGTGGTAACTGG - Intergenic
1202533867 Y:25848680-25848702 ATTTTGTTTGAGGTGGTATCTGG - Intergenic