ID: 978178879

View in Genome Browser
Species Human (GRCh38)
Location 4:105769305-105769327
Sequence CTGCAGACCTAGCCTTATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 106}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978178879_978178884 19 Left 978178879 4:105769305-105769327 CCATCATAAGGCTAGGTCTGCAG 0: 1
1: 1
2: 0
3: 8
4: 106
Right 978178884 4:105769347-105769369 CAGTGACAGTTTGCTGATAAAGG 0: 1
1: 0
2: 1
3: 20
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978178879 Original CRISPR CTGCAGACCTAGCCTTATGA TGG (reversed) Intronic
902755098 1:18543910-18543932 CTGAAGACCTGGCCTTAAAACGG - Intergenic
903911953 1:26733946-26733968 CTGCAGACCTTGCCCTATTGAGG - Intronic
907674242 1:56504060-56504082 CTACGCACCCAGCCTTATGAAGG + Intronic
911498014 1:98654229-98654251 CTGCAGAGGTAGCTTTAAGAGGG - Intergenic
914001076 1:143694928-143694950 TTTCAGACCCTGCCTTATGATGG + Intergenic
914198448 1:145463423-145463445 TTTCAGACCCTGCCTTATGATGG + Intergenic
914477554 1:148036551-148036573 TTTCAGACCCTGCCTTATGATGG + Intergenic
914513957 1:148357838-148357860 TTTCAGACCCTGCCTTATGATGG + Intergenic
918722091 1:187865925-187865947 CTGCAATCCTAGCCTTTTGGGGG - Intergenic
919699092 1:200612840-200612862 CTGCAGAACTTGGCTCATGAAGG - Intronic
921453190 1:215334534-215334556 CTGCACACCTACCATTATCAGGG - Intergenic
923245710 1:232130220-232130242 CTCCAGAGCTAGTCTCATGAAGG - Intergenic
1069760088 10:70804091-70804113 CTGCATGACTAGCCTTCTGATGG + Intergenic
1070337973 10:75471833-75471855 GTGCAGATGTAGCCTTTTGAGGG + Intronic
1082025919 11:47572092-47572114 CTGCAGACTGAGCCATGTGATGG + Intronic
1091449256 12:562433-562455 CTGCAGACCTGCCCTTCTGCAGG + Exonic
1094414166 12:30200916-30200938 CTGCAGACCCAGCCTCCTGCGGG - Intergenic
1097357775 12:58621152-58621174 CTGCAGACCTATCCTCCTGGTGG + Intronic
1098343652 12:69477131-69477153 CTGCATTCCTAGACTTCTGAGGG - Intronic
1101416478 12:104513037-104513059 CTGCATACCTAGACTCAGGAGGG - Intronic
1105797537 13:23870912-23870934 CTGCAGTCCCAGCCCTATGTGGG + Intronic
1106984446 13:35328694-35328716 CTGAAGACCCAGCATTATTAAGG + Intronic
1107743115 13:43475123-43475145 CAGCAGATCTATCATTATGATGG + Intronic
1107831683 13:44379987-44380009 GTGCAGACATAGCCTTAAAAGGG + Intronic
1109350108 13:61169301-61169323 CTGCAGACCTCCCCATGTGAAGG - Intergenic
1110019302 13:70449496-70449518 CTACAGACCTTGCTTTATAAGGG + Intergenic
1112711408 13:102133185-102133207 GTGCAGACCTAGAATTATAATGG - Intronic
1114725996 14:24938270-24938292 CTGCCCACCTAGGCTTAGGATGG + Intronic
1119425543 14:74532450-74532472 ATGCAGACCTGGCCTCATGCTGG - Exonic
1120853219 14:89189373-89189395 CTGAAGGCCTAGCCATAAGAAGG + Intronic
1122929256 14:104925920-104925942 CTGGAGACCAAGCGTTATGGGGG - Intronic
1125679785 15:41523470-41523492 CTGCAGGCTGAGCCTTCTGAAGG + Intronic
1133510066 16:6449573-6449595 CTGCACACAGAGCCTTATGATGG + Intronic
1134089933 16:11386160-11386182 CTGCAGACCTACCCTCTTCAGGG + Intronic
1135203994 16:20466749-20466771 CTTCAGACCTTGCATTCTGATGG - Intronic
1135215008 16:20558174-20558196 CTTCAGACCTTGCATTCTGATGG + Intronic
1140670637 16:77274958-77274980 CTCCAACCCTAGCCTTATCATGG + Intronic
1142620229 17:1160964-1160986 CTGCAGACGGTGCCTTCTGAGGG + Intronic
1142758546 17:2029832-2029854 CTGCAGGCCGAGTCTTGTGAAGG - Intergenic
1146162136 17:30565770-30565792 CTGGAGACATAGTCTTCTGAGGG + Intergenic
1146586874 17:34090369-34090391 CTGCAGACCTGGTGTTCTGATGG + Intronic
1148088696 17:45009733-45009755 CTGCAGACATGGTCTTATGAGGG - Intergenic
1150610393 17:66728660-66728682 CTGCAGACATAACCTAACGACGG - Intronic
1159251320 18:65880724-65880746 CTGCAGACATATGCTTTTGAAGG + Exonic
1159297017 18:66504957-66504979 CTCCAGACCTACGCTTTTGAGGG - Exonic
1160327388 18:77963455-77963477 CCACAGACCTTGCCTCATGAGGG - Intergenic
1162581033 19:11530454-11530476 CTGCAGAAATGGGCTTATGAGGG - Intergenic
1162943634 19:14029202-14029224 CAGAAGACCTAGCTTCATGAGGG + Intronic
1165980866 19:39721691-39721713 CTGCAGATCTAGCCTTATGATGG + Intergenic
928797925 2:35046773-35046795 ATACAGACAGAGCCTTATGAAGG + Intergenic
930741566 2:54837149-54837171 CTGTAAACCTAACCTTATTAAGG - Intronic
935460046 2:103319350-103319372 CTGGAGAGCCAGCCTTATGAGGG - Intergenic
936552404 2:113457566-113457588 CTGTAGACCTAACTTCATGAAGG - Intronic
1174303126 20:49596292-49596314 CTGCTGGCCTAGCCTTGGGAGGG - Intergenic
1175292073 20:57882582-57882604 GTGCAGACCCAGCCTTGGGAGGG + Intergenic
1177641992 21:23855452-23855474 CTGGAGACCTAGCTTCATGAAGG - Intergenic
1178738027 21:35170490-35170512 CTGCCAACTTAGCCTTGTGATGG - Intronic
1180763249 22:18224569-18224591 CTGCAGGGGTAGCCTTAGGAAGG + Intergenic
1180772398 22:18399978-18400000 CTGCAGGGGTAGCCTTAGGAAGG - Intergenic
1180803776 22:18649594-18649616 CTGCAGGGGTAGCCTTAGGAAGG - Intergenic
1180806988 22:18719855-18719877 CTGCAGGGGTAGCCTTAGGAAGG + Intergenic
1181217943 22:21345665-21345687 CTGCAGGGGTAGCCTTAGGAAGG + Intergenic
1182799939 22:33023755-33023777 CTCCAGACCTCACCTTATCAAGG - Intronic
1185421081 22:50734699-50734721 GTGCAGCCCTTTCCTTATGATGG + Intergenic
1203234237 22_KI270731v1_random:140966-140988 CTGCAGGGGTAGCCTTAGGAAGG - Intergenic
949508362 3:4747121-4747143 TTGGAGAAATAGCCTTATGATGG + Intronic
955302945 3:57800591-57800613 CTGCAGACTTACCATTATCAAGG - Intronic
957533496 3:81471121-81471143 CTGAAGACATAGATTTATGAGGG - Intergenic
963810986 3:149776388-149776410 GTGGAGACCAAGCCCTATGAGGG - Intronic
964670639 3:159221437-159221459 CTGCAGTCCTAGAATTCTGAAGG + Intronic
964870513 3:161309261-161309283 CTGCTGACCAAGCCGGATGATGG - Intergenic
968203008 3:196772206-196772228 TTTCAGGCCTAGCCTTATGTGGG + Intronic
970197782 4:13569979-13570001 CTGCTGCCCTAGGCTTATGGAGG - Exonic
972675902 4:41258684-41258706 CAGAACACCTAGCCTTAGGACGG - Intronic
973587395 4:52406974-52406996 GTGCAGACTTATCCTTATGGTGG - Intergenic
975211004 4:71699899-71699921 CTTCAGACCTAGACTTATCATGG + Intergenic
977081740 4:92538686-92538708 CTGCATTCCTAGTCTTAGGATGG + Intronic
977347949 4:95840994-95841016 CTGCAAACCTACCGTTATCATGG + Exonic
978178879 4:105769305-105769327 CTGCAGACCTAGCCTTATGATGG - Intronic
978574818 4:110179130-110179152 CTGGAGGCCTAGAATTATGAAGG - Intronic
983867578 4:172787371-172787393 CTCCAGACATTGCCTAATGATGG - Intronic
985876876 5:2606686-2606708 CTGCAGACCTAGCCTGAAGCAGG + Intergenic
985959923 5:3293619-3293641 CTGCAGACCTTGGCTTAGGGAGG + Intergenic
986046148 5:4040187-4040209 CTGCAGACCTGGGGTTCTGATGG - Intergenic
986399914 5:7370622-7370644 CTGGCCACCTAGCCTGATGAAGG + Intergenic
986569708 5:9152373-9152395 CTGCAGAACTAGCCTAGGGAAGG - Intronic
990973131 5:61531564-61531586 CTGCTGTCCTAGCCCTATCAGGG - Exonic
992020564 5:72619772-72619794 CTGCAGGCCAAGCCTCAGGAAGG - Intergenic
1000431105 5:161153320-161153342 ATGCAGAACTAGCCTGATGAAGG + Intergenic
1003180411 6:3786183-3786205 CTGCAGTCCTGGCCTTACGCTGG - Intergenic
1004121135 6:12823099-12823121 CTGCAGACATCGCCTAATTATGG + Intronic
1008528859 6:52435632-52435654 CTGCAGACCTGGACTATTGAAGG + Intronic
1009771445 6:68147386-68147408 CTGCAGACATTCCCTGATGAAGG - Intergenic
1019385614 7:754380-754402 CTGCAGTCCTAGCCCTGTGGAGG - Intronic
1024995078 7:55267953-55267975 CTCCAGTCCTAACCTTCTGATGG + Intergenic
1026280486 7:68917942-68917964 CTGCAGAATTTGCCATATGATGG - Intergenic
1026979926 7:74520241-74520263 CTGCATACCCAGCCTGATTAAGG + Intronic
1032563738 7:132918960-132918982 CTGCAAAGCAAGTCTTATGAGGG + Intronic
1033147787 7:138885861-138885883 CTGGAGACCTACACTTGTGATGG + Intronic
1033663745 7:143422281-143422303 CTCCAGACCTAGCCCTCTCATGG - Intergenic
1035154811 7:156903834-156903856 TTGCAGACCTAGAATTAGGATGG - Intergenic
1044211083 8:89552196-89552218 CTGCAGTCCTAACCTTTTGAGGG - Intergenic
1045124198 8:99071847-99071869 CTGCAGACCTGGGGTGATGATGG - Intronic
1049900596 9:159617-159639 CTGTAGACCTAACTTCATGAAGG + Intronic
1053743636 9:41169900-41169922 CTGTAGACCTAACTTCATGAAGG + Intronic
1054348912 9:63999716-63999738 CTGTAGACCTAACTTCATGAAGG + Intergenic
1054483635 9:65695406-65695428 CTGTAGACCTAACTTCATGAAGG - Intronic
1054684707 9:68261358-68261380 CTGTAGACCTAACTTCATGAAGG - Intronic
1055373930 9:75628428-75628450 CTCCACACCTGGCCTTGTGAAGG - Intergenic
1057173350 9:92976742-92976764 CTGCAGGCCTTTCCTTAGGAGGG + Intronic
1058375675 9:104318309-104318331 CTGCAGTCTTAGCATTATTAAGG - Intergenic
1058424847 9:104867329-104867351 CTGCAGACCTAGTATAATGCCGG + Intronic
1186724330 X:12340606-12340628 GTGCAGACCTTGCCTTACTAAGG - Intronic
1190421910 X:50293762-50293784 CTGCAGACCTATCCTAATTGAGG + Intronic
1192402581 X:70851229-70851251 CTGTATATCTAGCCTTATGCTGG - Intronic
1193939392 X:87661519-87661541 CAGCAGAACAAGCCTTATTATGG + Intronic