ID: 978180033

View in Genome Browser
Species Human (GRCh38)
Location 4:105782667-105782689
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313381
Summary {0: 667, 1: 17806, 2: 62788, 3: 103910, 4: 128210}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978180033_978180036 -10 Left 978180033 4:105782667-105782689 CCTCCTCCTGGGTTCAAACGATT 0: 667
1: 17806
2: 62788
3: 103910
4: 128210
Right 978180036 4:105782680-105782702 TCAAACGATTCTCATGCCTCAGG 0: 3
1: 81
2: 1044
3: 2616
4: 2719
978180033_978180039 6 Left 978180033 4:105782667-105782689 CCTCCTCCTGGGTTCAAACGATT 0: 667
1: 17806
2: 62788
3: 103910
4: 128210
Right 978180039 4:105782696-105782718 CCTCAGGTCCCCTAGTAGCTGGG 0: 1
1: 25
2: 965
3: 23156
4: 244523
978180033_978180037 5 Left 978180033 4:105782667-105782689 CCTCCTCCTGGGTTCAAACGATT 0: 667
1: 17806
2: 62788
3: 103910
4: 128210
Right 978180037 4:105782695-105782717 GCCTCAGGTCCCCTAGTAGCTGG No data
978180033_978180041 14 Left 978180033 4:105782667-105782689 CCTCCTCCTGGGTTCAAACGATT 0: 667
1: 17806
2: 62788
3: 103910
4: 128210
Right 978180041 4:105782704-105782726 CCCCTAGTAGCTGGGATTACAGG 0: 162
1: 6363
2: 112471
3: 263921
4: 243656

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978180033 Original CRISPR AATCGTTTGAACCCAGGAGG AGG (reversed) Intronic