ID: 978180034

View in Genome Browser
Species Human (GRCh38)
Location 4:105782670-105782692
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 488651
Summary {0: 1012, 1: 28064, 2: 97665, 3: 163311, 4: 198599}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978180034_978180039 3 Left 978180034 4:105782670-105782692 CCTCCTGGGTTCAAACGATTCTC 0: 1012
1: 28064
2: 97665
3: 163311
4: 198599
Right 978180039 4:105782696-105782718 CCTCAGGTCCCCTAGTAGCTGGG 0: 1
1: 25
2: 965
3: 23156
4: 244523
978180034_978180037 2 Left 978180034 4:105782670-105782692 CCTCCTGGGTTCAAACGATTCTC 0: 1012
1: 28064
2: 97665
3: 163311
4: 198599
Right 978180037 4:105782695-105782717 GCCTCAGGTCCCCTAGTAGCTGG No data
978180034_978180041 11 Left 978180034 4:105782670-105782692 CCTCCTGGGTTCAAACGATTCTC 0: 1012
1: 28064
2: 97665
3: 163311
4: 198599
Right 978180041 4:105782704-105782726 CCCCTAGTAGCTGGGATTACAGG 0: 162
1: 6363
2: 112471
3: 263921
4: 243656

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978180034 Original CRISPR GAGAATCGTTTGAACCCAGG AGG (reversed) Intronic