ID: 978180035

View in Genome Browser
Species Human (GRCh38)
Location 4:105782673-105782695
Sequence CATGAGAATCGTTTGAACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 455404
Summary {0: 83, 1: 3830, 2: 57947, 3: 166820, 4: 226724}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978180035_978180041 8 Left 978180035 4:105782673-105782695 CCTGGGTTCAAACGATTCTCATG 0: 83
1: 3830
2: 57947
3: 166820
4: 226724
Right 978180041 4:105782704-105782726 CCCCTAGTAGCTGGGATTACAGG 0: 162
1: 6363
2: 112471
3: 263921
4: 243656
978180035_978180039 0 Left 978180035 4:105782673-105782695 CCTGGGTTCAAACGATTCTCATG 0: 83
1: 3830
2: 57947
3: 166820
4: 226724
Right 978180039 4:105782696-105782718 CCTCAGGTCCCCTAGTAGCTGGG 0: 1
1: 25
2: 965
3: 23156
4: 244523
978180035_978180037 -1 Left 978180035 4:105782673-105782695 CCTGGGTTCAAACGATTCTCATG 0: 83
1: 3830
2: 57947
3: 166820
4: 226724
Right 978180037 4:105782695-105782717 GCCTCAGGTCCCCTAGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978180035 Original CRISPR CATGAGAATCGTTTGAACCC AGG (reversed) Intronic