ID: 978180039

View in Genome Browser
Species Human (GRCh38)
Location 4:105782696-105782718
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268670
Summary {0: 1, 1: 25, 2: 965, 3: 23156, 4: 244523}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978180033_978180039 6 Left 978180033 4:105782667-105782689 CCTCCTCCTGGGTTCAAACGATT 0: 667
1: 17806
2: 62788
3: 103910
4: 128210
Right 978180039 4:105782696-105782718 CCTCAGGTCCCCTAGTAGCTGGG 0: 1
1: 25
2: 965
3: 23156
4: 244523
978180035_978180039 0 Left 978180035 4:105782673-105782695 CCTGGGTTCAAACGATTCTCATG 0: 83
1: 3830
2: 57947
3: 166820
4: 226724
Right 978180039 4:105782696-105782718 CCTCAGGTCCCCTAGTAGCTGGG 0: 1
1: 25
2: 965
3: 23156
4: 244523
978180034_978180039 3 Left 978180034 4:105782670-105782692 CCTCCTGGGTTCAAACGATTCTC 0: 1012
1: 28064
2: 97665
3: 163311
4: 198599
Right 978180039 4:105782696-105782718 CCTCAGGTCCCCTAGTAGCTGGG 0: 1
1: 25
2: 965
3: 23156
4: 244523

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type