ID: 978180041

View in Genome Browser
Species Human (GRCh38)
Location 4:105782704-105782726
Sequence CCCCTAGTAGCTGGGATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 626573
Summary {0: 162, 1: 6363, 2: 112471, 3: 263921, 4: 243656}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978180034_978180041 11 Left 978180034 4:105782670-105782692 CCTCCTGGGTTCAAACGATTCTC 0: 1012
1: 28064
2: 97665
3: 163311
4: 198599
Right 978180041 4:105782704-105782726 CCCCTAGTAGCTGGGATTACAGG 0: 162
1: 6363
2: 112471
3: 263921
4: 243656
978180035_978180041 8 Left 978180035 4:105782673-105782695 CCTGGGTTCAAACGATTCTCATG 0: 83
1: 3830
2: 57947
3: 166820
4: 226724
Right 978180041 4:105782704-105782726 CCCCTAGTAGCTGGGATTACAGG 0: 162
1: 6363
2: 112471
3: 263921
4: 243656
978180033_978180041 14 Left 978180033 4:105782667-105782689 CCTCCTCCTGGGTTCAAACGATT 0: 667
1: 17806
2: 62788
3: 103910
4: 128210
Right 978180041 4:105782704-105782726 CCCCTAGTAGCTGGGATTACAGG 0: 162
1: 6363
2: 112471
3: 263921
4: 243656

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978180041 Original CRISPR CCCCTAGTAGCTGGGATTAC AGG Intronic
Too many off-targets to display for this crispr